[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVR01_0033_F04

Library: OVR01 (Ovary)
Individual: LWD1, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,291)  [FASTA format sequence]
TCTTCCGTAA CCCCTGCACA GAACAGGTTT TGAAACTTCT GGACAATTTG CTTGCCCTTA
TAAGAACTCA CAATTCTTTA TATGCACCAG AA
ATGCTAGC CAAACTAGGA GAACCTTTCA
GCAAGGCTCT GGATATGATT GATGCGGAAA AATCTACTAT TTTAGGATTA CCTCAACCTC
TCCTGGACCT GAATGACTCT CCTGTCTACA AAACGATCTT GGAAAAAATG CAGCGTTTCT
TCTGCACCCT CTATGAAAAC TGTTTCCACA TCCTAGGGAA GGCAGGCCCT TCCATGCAGC
AGGACTTCTA CACCGTGGAG CAGCTGTCCA CCCAGCTCCT CAGCTCTGCC TTTGTCAACT
TGGACAATCT TCCTGACTAC CGACTCAGAC CCTTGCTTCG GGTCTTCGTG AAGCCTCTGG
TGCTCGCCTG TACCCCCGAG TACTATGAAA GCCTGGTGTC GCCCATCGTT GGGCCTCTTT
TCACCTACCT CCACATGAGG CTTTCCCAAA AATGGCAAAT CATCAACCAG AGGAGCATGC
TGTGTGAAGA TGAGACAACA GATGAAAACC CAGAGTCTCA AGAGATGCTG GAGGAACAAC
TGGTGAGGAT GTTAACCCGA GAAGTCGTGG ACCTGATCAC CGTGTGCTGT GTCTCAAAGA
AGGGTGCTGA CCACACTGCT ACTCCCGCTG CGGATGGAGA GGATGAAGAG ATGATGGCCA
CCGAGGTAGC CACTCCGGCC ACGGCAGAGC TCACAGACCT GGGAAAGTGT CTGACGAAGC
ACGAGGATGT TTGCACAGCG CTGTTAATTC TAGCCTTCAA CTCCCTCGCC TGGAAGGATA
CTCTGTCCTG CCAGAGGACC ACCACGCAGC TCTGCTGGCC CCTCCTCAAG CAAGTGCTAT
CGGGGACTCT GCTGGCAGAA GCTGTCACAT GGCTCTTCAC CAGCGTGCTG AAGGGCTTAC
AGACACACGG GCAGCATGAC GGCTGCATGG CTTCCTTGGT CCACCTGGCC TTCCAGACGT
ATGAGGCGCT GCGTCCCAGG TACGTGGAGA TAAGAGCTGT GATGGAGCAG ATCCCTGACA
TTCAGAAGGA GTCTCTGGAC CAGTTTGACT GCAAGCTTTT GAACCCCTCT CTGCAGAAAG
CGGCTGATAA GCGCCGGAAG GACCAATTCA AACGCCTGAT TGCTGGGTGC ATCGGGAAAC
CCTTGGGCGA GCAGTTCCGA AAAGAAGTTC ACATTAAGAA TCTTCCTTCA CTTTTCAAAA
AAACAAAGCC AACCCATGAC TCGGATGCAC TGGACAACGA CGAGGGCGGC CTGGCCACCA
TCTTTGAACC CTGAATCAAG CTTTCAGGCA TCCTTCTTTG ACCTTTATTG TCATCTCTTC
TTCCCCTTTG TAGCTAATCT CTAGGCCCCT CTCCACTGCA CCTCACTTTC CACCTTCGTC
AGCCTGGAGA GAGGTCCAGG TCTGGAGCTG GAGAGAGTGG GCCCTGTAGT AGGGCCAGAA
GTCATTATAC TAAAGTCTCA AGAAAGGGAG GTAGGGCTTC TACCGTTCTG TCTAGATTTC
CCAGGTCTCT CCCATTCTAC TTGGAGTTTT GGCTTTTCCA AAAGTGAGAA GCCACAGCAG
AGTGGCCCCT ATCCCCAAGC CCTCTCACCC CCAGGCAGCC GTATACACCT GTGCAGAGTG
ACAACCAGGG GGCTCTGTAC CTGATGCTGT ACTGGCTGGG CTTGCGGCCA GGGCTCAGCC
CTGAACTACT TGTGCCAGAG TTTCTCTTGG ACCTTTGAGA AATCCCACCA AGCCCCCTTG
CTGCTGGGCT GGCTGGGAAC CCTCCCCATC CCCCAGGGGT GTATCTGGGT CAGGTGCTGA
GTGAACTGAA TTTGGCCAAT TCCCACTTTG TTTTGAGCAA GAATCTGATG GGCTCCATGG
TACAGGCTAA GCTCTGGGCA CAGTGTCACG ATAGTACCTT CAGGGACCAG GGCTGGGCAG
GGGCCGCAGT GTTCTCTGAT ATCCCTTAGA GCTCACACAT TTTGTCCTTC CGTGAATGAC
CCTTCAGTGT GGTTTCCCCA GCCCCCAGGG TCCACTCAGG CACAAGAGCC ACAGTACCCT
CTCTAGTGTC ACGTGATGCC GTTGGCATTT AAGGATAATC CAGACCAACT AGGCTACATC
TGTGACAGCA GCTAGCAAAG CCACTGGTCT CCTCTCCTAG CTGAGTCCAG GTGCCTTCAA
AGTCTCATGC TCTTTCAGAC CCCCCTGGTC ACCTCCTTCC TGGGCCATTT CTAAAAAAAA
AAAAAAAAAA A

Deduced amino acid sequence:  (length: 413) [FASTA format sequence]
MLAKLGEPFS KALDMIDAEK STILGLPQPL LDLNDSPVYK TILEKMQRFF CTLYENCFHI
LGKAGPSMQQ DFYTVEQLST QLLSSAFVNL DNLPDYRLRP LLRVFVKPLV LACTPEYYES
LVSPIVGPLF TYLHMRLSQK WQIINQRSML CEDETTDENP ESQEMLEEQL VRMLTREVVD
LITVCCVSKK GADHTATPAA DGEDEEMMAT EVATPATAEL TDLGKCLTKH EDVCTALLIL
AFNSLAWKDT LSCQRTTTQL CWPLLKQVLS GTLLAEAVTW LFTSVLKGLQ THGQHDGCMA
SLVHLAFQTY EALRPRYVEI RAVMEQIPDI QKESLDQFDC KLLNPSLQKA ADKRRKDQFK
RLIAGCIGKP LGEQFRKEVH IKNLPSLFKK TKPTHDSDAL DNDEGGLATI FEP


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinXPO5exportin-5 [Homo sapiens]. 8000.0


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinXpo5exportin-5 [Mus musculus]. 7490.0


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474913PREDICTED: similar to exportin 5 isoform 3 [Canis familiaris]. 7940.0


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinXPO5PREDICTED: exportin 5 [Bos taurus]. 8050.0


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100155084PREDICTED: LOW QUALITY PROTEIN: exportin-5 [Sus scrofa]. 3264e-89


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-112204.1GTTGGCATTTAAGGATAATCCAGACCAACTAGGCTACATCTGTGACAGCAGCTAGCAAAG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0035387fwd
2003082620030826C-0008798fwd
2005032220050322C-00138910fwd
2006061120060611C-00675211fwd
2007080620070806C-00819711fwd
2008051520080515C-00301813fwd
2010100120101001C-00779811fwd
2011060120110601C-00348611fwd