[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVR01_0092_E11

Library: OVR01 (Ovary)
Individual: LWD1, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,271)  [FASTA format sequence]
TATCCCGGAG GCTCTGGTTC CAGGGGGACT GGGACGCGGA AATGGAAGAG CGGGCGTTCC
CCAACCCTTT CCCGGACTAT GAGGCCGCGG CCGCCGTGCC GGCGGAGGAG CCGCCATGTG
CTCGCCCTGC GCTCACCCCA GAGGAGCTCG GCCTCCCTTT CCACAGCGAC GGGAAGATCA
TTCATAATTT CACAAGGCGG ATCCAGAGCA AAATCAAAGA TCTTCTACAG CAGATGGAAG
AAGGGCTGAA GACAGCTGAT CCGCACGATT GCTCTGCTTA CACGGGTTGG ACAGGCATAG
CCCTTTTGTA CCTTCAATTG TACCGGGTCA CATGTGACCA GAACTATCTG CTCCGATCCC
TGGATTACGT AAAAAGAACA CTTCGGAATC TGAACGGCCG GAGGGTCACT TTCCTCTGTG
GAGATGCCGG GCCCCTGGCT GTCGGAGCTG TGGTGTATCA CAAACTCAAA AGTGATGGCG
AGTCCCAGGA ATGCATCACA AAACTCCTGC AGCTCCAGAG AACCATCGTC TGCCGCGACT
CGGACCTTCC CGATGAGCTG CTTTTCGGCC GCGCGGGCTA CCTGTACGCC TTGCTCTATG
TGAACACGGA GATGGGTCCG GGCGCCGTGT GCGAATCAGC CATCAAAGAG GTGGTCGATG
CTATTATTGA TTCGGGCAAG ACTTTGTCAA AGGAAGAAAG GAAGGCCGAG CGCTGCCCCC
TGTTGTACCA GTGGCACAGG AAGCAGTACG TCGGAGCCGC CCATGGCATG GCTGGGATCT
ACTACATGCT AATGCAGCCA GCAGCAAAAG TGGACCAAGA AACCTTGACA GAGATGGTGA
AGCCTAGTAT TGACTACATG CGCCACAAAA GGTTCCGATC CGGAAACTAC CCATCCTCGT
TAAGCAACGA GACAGACCGC CTGGTACACT GGTGCCACGG GGCGCCCGGC GTCATCCACA
CGCTCATGCA GGCGTACAAG GTGTTTAAGG AGGAGAAGTA CCTGAGGGAC GCCGTGGAGT
GCAGCGACGT GATTTGGCAG CGGGGCCTGC TGCGCAAGGG CTACGGCATC TGCCACGGGA
CTGCGGGCAA CGGCTACTCC TTCCTCTCCC TTTACCGCCT CACGCAGGAC AAGAAGTACC
TCTACCGAGC TTGCAAGTTT GCAGAGTGGT GTCTGGAGTA CGGAGCACAT GGTTGCCGCA
TTCCCGACAG GCCCTACTCT CTCTTCGAAG GCATGGCCGG CGCCATTCAC TTCCTCTCCG
ACATCCTGGC CCCCGAGACA GCACGGTTTC CAGCATTTGA ACTCGGCTCT TCAGAGAGGG
ATCCAAAGGT GCAAAAAGAC TCCTAAGGGA CCCGACGGGA CCACAGGCCG CCAGGTTGCC
TGGCGCCTGA CACAGAAGCC ACCGTGCATC CTGAGGAAGG GAGGACGGAG GGAGCAGAGC
CCCGCAGACC CCCGCCCCGC CAGCCTGCTG TGACCGTGCT CCCCTCGCTG GTGTCAGCGT
GACGTCTCCG TGTCCAGTGC TGCGTAATGT TTGCATGTCC CTCGGTGTTT GCTCTCCGTA
GGCGTAGGTT GTTCTCAGCG GAAGCCCTTC TCTGTCCATG AGCCCGAGCT GGCCGTGCAT
GAGGGCACAC AGCAGCCCCT TCTCCGTACC CAATAAAGCG GGGTGCTTCT GTATTGGCAG
ACAGGACACA GGCAGGTGGT GCCTCTCTTA TGTACCAGAA AGACTCTCTT TTAAGATGCC
ATCCCAGTGT GAGACTTTTC CCAGCATTTC CTGTGGGACC CTTTTGGGGG AGCTTGAGAG
AAAGACTGCT CCAGAAATGA AAAGAAATAG CGGAGGTAGA GGGGCTTTCG CTGGAGGGGG
GCTGGGGAGC CTTGGCCCCA GTTGGACCAG CCCCTCTGTG GGTCTTATGC TCACCTTCGT
GGTTTTAGGA AGCCCGAGGG GGCGCGTGGC AGCTCTGCCG GGCTCCCACT CGCAGGCTCT
TAGTGTGAAG TTCCAGACCC TTGAAATCCA GGGCAGTCCG TGCCCTGGGG AGGGGACCGA
TGACACCGGT GACGGCGGTT CGGGGGAAGC CTTGTCATGG CCACATGCGA ACCAAGCAGT
AGTGCCGTGT TTGTTACTAA ACAGACTGCA CCTCAGTTTT ATCAGCATCG TAACGTCTTG
TTCCAAGTTC AGCAGATACA GTTCCGGATG GGCAGTAAGC AGAAAGACAT TCAGCTGTTC
CCATGTCCCT CCAATTAAAC TTATTTCAAA ATTCAAAAAA AAAAAAAAAA A

Deduced amino acid sequence:  (length: 434) [FASTA format sequence]
MEERAFPNPF PDYEAAAAVP AEEPPCARPA LTPEELGLPF HSDGKIIHNF TRRIQSKIKD
LLQQMEEGLK TADPHDCSAY TGWTGIALLY LQLYRVTCDQ NYLLRSLDYV KRTLRNLNGR
RVTFLCGDAG PLAVGAVVYH KLKSDGESQE CITKLLQLQR TIVCRDSDLP DELLFGRAGY
LYALLYVNTE MGPGAVCESA IKEVVDAIID SGKTLSKEER KAERCPLLYQ WHRKQYVGAA
HGMAGIYYML MQPAAKVDQE TLTEMVKPSI DYMRHKRFRS GNYPSSLSNE TDRLVHWCHG
APGVIHTLMQ AYKVFKEEKY LRDAVECSDV IWQRGLLRKG YGICHGTAGN GYSFLSLYRL
TQDKKYLYRA CKFAEWCLEY GAHGCRIPDR PYSLFEGMAG AIHFLSDILA PETARFPAFE
LGSSERDPKV QKDS


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL2lanC-like protein 2 [Homo sapiens]. 7860.0O
Contig/Assembly ProteinLANCL1lanC-like protein 1 [Homo sapiens]. 487e-137O
Contig/Assembly ProteinLANCL3lanC-like protein 3 isoform 2 [Homo sapiens]. 2099e-54


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLancl2lanC-like protein 2 [Mus musculus]. 7540.0O
Contig/Assembly ProteinLancl1lanC-like protein 1 [Mus musculus]. 485e-137
Contig/Assembly ProteinLancl3lanC-like protein 3 [Mus musculus]. 2097e-54


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC483240PREDICTED: similar to LanC-like protein 2 (Testis-specific adriamycin sensitivity protein) [Canis familiaris]. 7540.0O
Contig/Assembly ProteinLOC478897PREDICTED: similar to LanC-like protein 1 (40 kDa erythrocyte membrane protein) (p40) [Canis familiaris]. 484e-136O
Contig/Assembly ProteinLOC491823PREDICTED: similar to LanC lantibiotic synthetase component C-like 3 [Canis familiaris]. 2112e-54O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL2lanC-like protein 2 [Bos taurus]. 8150.0O
Contig/Assembly ProteinLANCL1lanC-like protein 1 [Bos taurus]. 488e-137O
Contig/Assembly ProteinLANCL3lanC-like protein 3 [Bos taurus]. 2113e-54


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100620078PREDICTED: lanC-like protein 2-like, partial [Sus scrofa]. 7850.0
Contig/Assembly ProteinLOC100153701PREDICTED: lanC-like protein 1 [Sus scrofa]. 463e-130
Contig/Assembly ProteinLOC100626898PREDICTED: lanC-like protein 3-like [Sus scrofa]. 1872e-47
Contig/Assembly ProteinLOC100625232PREDICTED: lanC-like protein 1-like [Sus scrofa]. 1042e-22


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-117884.1GTAAGCAGAAAGACATTCAGCTGTTCCCATGTCCCTCCAATTAAACTTATTTCAAAATTC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2005032220050322C-0060043fwd
2006061120060611C-00131413fwd
2007080620070806C-00153613fwd
2008051520080515C-00282915fwd
2010100120101001C-00262321fwd
2011060120110601C-01329122fwd