[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVR01_0100_D08

Library: OVR01 (Ovary)
Individual: LWD1, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,242)  [FASTA format sequence]
GATTGCTCGG GTCTGGCGGC GGCAGCATGG CGGCGGGGGC GGCCGAGGCG GCGGCGGCTG
TGGTGGAGGT CGGCTCCGCC GGGCAGTTTG AGGAGCTGCT GCGCCTAAGA GCCAAGTCCC
TGCTGGTGGT CCATTTCTGG GCACCATGGG CCCCACAGTG TGCTCAGATG AACGATGTGA
TGGCCGAGTT AGCCAAGGAG CACCCGCAAG TTTCCTTTGT GAAGTTGGAG GCTGAAGCTG
TTCCTGAAGT GTCTGAAAAA TACGGAATTA GTTCTGTACC CACCTTTCTG TTTTTCAAGA
ATTCTCAGAG CATTGACCGG TTAGATGGTG CACATGCCCC AGAGTTGACC AAAAAGGTTC
AGCGACATGC GTCCAGCAGC TCTTTCCCAT CTGGCGGTAG CGAGCACCTG AAAGAAGACC
TCAGCCTTCG CCTGAAGAAG CTGACCCACG CTGCCCCCTG CATGCTGTTC ATGAAGGGAA
CACCCCAGGA GCCGCGCTGC GGTTTCAGCA AGCAGATGGT GGAAATTCTT AACAAACATA
ATATCCAGTT TAGCAGTTTT GATATCTTCT CAGATGAAGA AGTTCGCCAA GGCCTCAAAA
CCTATTCCAA TTGGCCCACC TACCCCCAGC TCTATGTTTC TGGAGAGCTC ATAGGAGGAC
TTGATATAAT CAAGGAGCTA GAAGCATCTA AAGAACTAGA TACAATTTGC CCCAAAGCTC
CCAAATTAGA GGAAAGGCTC AAAGTACTGA CAAATAAAGC TTCTGTGATG CTCTTTATGA
AGGGAAACAA ACAGGAAGCC AAGTGTGGTT TCAGCAGACA AATCCTGGAA ATTCTAAATA
GTACTGGTGT CGACTACGAG ACGTTCGACA TACTGGAGGA TGAGGAAGTC CGGCAGGGGT
TGAAAACCTA CTCCAACTGG CCGACGTACC CTCAGCTGTA TGTGAAAGGG GAGCTGGTCG
GAGGCCTGGA TATTGTTAAG GAACTAAAAG AAAACGGTGA GCTGCTGCCT ATCCTGAAAG
GAGAAAACTA ATCAGTGGGG GACTTGGTGC CCAGCTACTG CAGGAGGCCG TCACTCCGCT
GAGTGACCAG TCCCTGAGGT GGCCGAGGAG TAGGAGATGC TTATCCCCGG TTACGCTGGT
GTATTTCTCG AGGCTGCGCT AAGTGAGCGG ATGCGACGTG TTTTCCACCC AAATGAGAAC
ACAATAAACA TCTTCAAGTT CAATTGAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 334) [FASTA format sequence]
MAAGAAEAAA AVVEVGSAGQ FEELLRLRAK SLLVVHFWAP WAPQCAQMND VMAELAKEHP
QVSFVKLEAE AVPEVSEKYG ISSVPTFLFF KNSQSIDRLD GAHAPELTKK VQRHASSSSF
PSGGSEHLKE DLSLRLKKLT HAAPCMLFMK GTPQEPRCGF SKQMVEILNK HNIQFSSFDI
FSDEEVRQGL KTYSNWPTYP QLYVSGELIG GLDIIKELEA SKELDTICPK APKLEERLKV
LTNKASVMLF MKGNKQEAKC GFSRQILEIL NSTGVDYETF DILEDEEVRQ GLKTYSNWPT
YPQLYVKGEL VGGLDIVKEL KENGELLPIL KGEN


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin-3 [Homo sapiens]. 595e-170O
Contig/Assembly ProteinGLRX5glutaredoxin-related protein 5, mitochondrial precursor [Homo sapiens]. 1033e-22
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Homo sapiens]. 56.26e-08
Contig/Assembly ProteinTXNthioredoxin [Homo sapiens]. 53.54e-07


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGlrx3glutaredoxin-3 [Mus musculus]. 598e-171O
Contig/Assembly ProteinGlrx5glutaredoxin-related protein 5, mitochondrial [Mus musculus]. 1032e-22
Contig/Assembly ProteinTxnl1thioredoxin-like protein 1 [Mus musculus]. 56.25e-08
Contig/Assembly ProteinTxndc2thioredoxin domain-containing protein 2 isoform 1 [Mus musculus]. 55.87e-08


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477869PREDICTED: similar to Thioredoxin-like 2 protein (PKC-interacting cousin of thioredoxin) (PKCq-interacting protein) (PKC-theta-interacting protein) [Canis familiaris]. 600e-172O
Contig/Assembly ProteinLOC474798PREDICTED: similar to Thioredoxin (ATL-derived factor) (ADF) (Surface associated sulphydryl protein) (SASP) [Canis familiaris]. 521e-06


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin-3 [Bos taurus]. 608e-174O
Contig/Assembly ProteinGLRX5glutaredoxin-related protein 5, mitochondrial [Bos taurus]. 1027e-22
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Bos taurus]. 55.51e-07
Contig/Assembly ProteinTXNthioredoxin [Bos taurus]. 53.93e-07O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin 3 [Sus scrofa]. 620e-178
Contig/Assembly ProteinLOC100154744PREDICTED: glutaredoxin-related protein 5, mitochondrial-like [Sus scrofa]. 1024e-22
Contig/Assembly ProteinTXNthioredoxin [Sus scrofa]. 54.31e-07


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-118554.1GCGGATGCGACGTGTTTTCCACCCAAATGAGAACACAATAAACATCTTCAAGTTCAATTG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2005032220050322S-0249741fwd
2006061120060611S-0323461fwd
2007080620070806S-0541411fwd
2010100120101001S-0770731fwd
2011060120110601S-0824851fwd