[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRM1_0027_B07

Library: OVRM1 (Ovary)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 1,323)  [FASTA format sequence]
GCCTTCCCTT TCCTCGCCTC TCGTTTCCCC CCTCCCATCC CGTTTCCTCG GCCGCTCCGC
TCCCTGGCGT GACTCGGCAC TGAGAGCCCC GGGAGAAGAC GCCACGGTCG CCACCTCCTG
TGTCCAGGCC TCGGCCTTCC TGAGTCTACC CCCGTCCCCT CCCGGGTCGT CTTCTCCTTC
AGTTTTGAAA CCGGTGGCGT CGCGGCCACC TTGCCAGGCT CTCTGAGA
AT GGTAGGTGTA
AAGCCGGTCG GGAGTGACCC GGATTTCCAG CCGGAGCTGA GCGGCGCGGG CTCCAGACCC
GCTGTGGTCA AATTCACCAT GCGAGGGTGT GGACCATGTT TAAGGATTGC CCCAGCATTC
AGTTCTATGA GTAATAAGTA TCCACAAGCA GTTTTCTTGG AAGTAGATGT ACATCAGTGT
CAGGGAACTG CTGCCACCAA CAACATATCA GCGACACCTA CATTTTTGTT TTTCCGAAAC
AAAGTGAGAA TTGATCAGTA TCAAGGAGCA GATGCCGTGG GATTAGAAGA AAAAATCAAG
CAGCACTTAG AAAACGACCC TGGAAGCAAT GAGGACACAG ATATTCCAAA AGGCTATATG
GATTTAATGC CTTTTATTAA CAAAGCTGGC TGTGAATGTC TTAATGAAAG TGACGAGCAT
GGATTTGACA ACTGTTTACG AAAAGACATG ACCTTCCTGG AATCTGATTG TGATGAACAG
CTACTTATTA CTGTGGCATT CAATCAGCCT GTTAAGCTTT ACTCAATGAA ATTTCAAGGG
CCAGATAATG GTCAGGGTCC TAAATATGTA AAAATTTTTA TCAATCTACC CCGATCTATG
GATTTTGAAG AGGCAGAAAG AAGCGAACCA ACTCAAGCTC TGGAACTAAC AGAGGATGAT
ATTAAAGAAG ATGGTATTGT TCCACTTCGT TATGTTAAGT TTCAGAATGT TAACAGTGTA
ACTATATTTG TTCAGTCCAA TCAAGGTGGA GAAGAAACAA CAAGAATTTC ATATTTTACT
TTTATTGGGA CTCCGGTCCA GGCAACAAAT ATGAATGACT TCAAACGAGT AGTTGGCAAA
AAAGGAGAAA GCCACTGAGG TACAAAAGAC ACTGGAAGAC CGTATTGCAA TCAGATCTAC
AGCTCCTGGA TAATTGCTTG ATTCTCGCCA GAGACTTTTC TATATTTCAT TCATTGCCAT
TACCAATAAA TCATTGCTTT TGTTCGGATG GTATCACTAG TGTTTCTATT GTAATCTTGA
TACATGCAGT TGTAAATAAA AGTAATAACT ACTTTTGCCA AGCTTAAAAA AAAAAAAAAA
AAA

Deduced amino acid sequence:  (length: 289) [FASTA format sequence]
MVGVKPVGSD PDFQPELSGA GSRPAVVKFT MRGCGPCLRI APAFSSMSNK YPQAVFLEVD
VHQCQGTAAT NNISATPTFL FFRNKVRIDQ YQGADAVGLE EKIKQHLEND PGSNEDTDIP
KGYMDLMPFI NKAGCECLNE SDEHGFDNCL RKDMTFLESD CDEQLLITVA FNQPVKLYSM
KFQGPDNGQG PKYVKIFINL PRSMDFEEAE RSEPTQALEL TEDDIKEDGI VPLRYVKFQN
VNSVTIFVQS NQGGEETTRI SYFTFIGTPV QATNMNDFKR VVGKKGESH


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Homo sapiens]. 584e-167O
Contig/Assembly ProteinTXNthioredoxin [Homo sapiens]. 83.25e-16O
Contig/Assembly ProteinTXNDC2thioredoxin domain-containing protein 2 isoform 1 [Homo sapiens]. 71.22e-12
Contig/Assembly ProteinTXNDC8thioredoxin domain-containing protein 8 [Homo sapiens]. 62.49e-10


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTxnl1thioredoxin-like protein 1 [Mus musculus]. 582e-166O
Contig/Assembly ProteinTxn1thioredoxin [Mus musculus]. 82.47e-16O
Contig/Assembly ProteinTxndc2thioredoxin domain-containing protein 2 isoform 1 [Mus musculus]. 68.98e-12
Contig/Assembly ProteinTxndc8thioredoxin domain-containing protein 8 [Mus musculus]. 62.86e-10


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC483970PREDICTED: similar to Thioredoxin-like protein 1 (32 kDa thioredoxin-related protein) [Canis familiaris]. 521e-148O
Contig/Assembly ProteinLOC474798PREDICTED: similar to Thioredoxin (ATL-derived factor) (ADF) (Surface associated sulphydryl protein) (SASP) [Canis familiaris]. 80.53e-15
Contig/Assembly ProteinLOC490552PREDICTED: similar to Thioredoxin domain containing protein 2 (Spermatid-specific thioredoxin-1) (Sptrx-1) [Canis familiaris]. 71.22e-12
Contig/Assembly ProteinLOC477869PREDICTED: similar to Thioredoxin-like 2 protein (PKC-interacting cousin of thioredoxin) (PKCq-interacting protein) (PKC-theta-interacting protein) [Canis familiaris]. 60.54e-09
Contig/Assembly ProteinLOC612304PREDICTED: similar to thioredoxin family Trp26 [Canis familiaris]. 59.76e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Bos taurus]. 584e-167
Contig/Assembly ProteinTXNthioredoxin [Bos taurus]. 84.32e-16O
Contig/Assembly ProteinTXNDC8thioredoxin domain-containing protein 8 [Bos taurus]. 76.65e-14
Contig/Assembly ProteinPITHD1PITH domain-containing protein 1 [Bos taurus]. 59.76e-09
Contig/Assembly ProteinGLRX3glutaredoxin-3 [Bos taurus]. 55.88e-08


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100512385PREDICTED: thioredoxin-like protein 1-like, partial [Sus scrofa]. 3222e-88
Contig/Assembly ProteinTXNthioredoxin [Sus scrofa]. 83.23e-16
Contig/Assembly ProteinLOC100623715PREDICTED: thioredoxin domain-containing protein 2-like [Sus scrofa]. 64.71e-10
Contig/Assembly ProteinTXNDC8thioredoxin domain-containing protein 8 [Sus scrofa]. 60.52e-09
Contig/Assembly ProteinLOC100620706PREDICTED: PITH domain-containing protein 1-like [Sus scrofa]. 59.74e-09


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-060454.1GCTTTTGTTCGGATGGTATCACTAGTGTTTCTATTGTAATCTTGATACATGCAGTTGTAA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-00052111fwd
2003082620030826C-00399912fwd
2005032220050322C-00546819fwd
2006061120060611C-00611125fwd
2007080620070806C-00099925fwd
2008051520080515C-00190327fwd
2010100120101001C-00710132fwd
2011060120110601C-00777437fwd