[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRM1_0053_F06

Library: OVRM1 (Ovary)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 2,870)  [FASTA format sequence]
CTTTTTGCCC TAAACCGGGC TTTGGACTAC ATTTCCCAGA TGGCTTTGCT TCCCGGCCTG
TGCTACTTTA TCAGGGCGTG TCTTGGAAGA GAAGCCCAAT CCCCTAGCTA CGCTGGGACC
TCTCGCTGCG CTTCAGCAGC CGCAGCTGCC TCTAGGCAAG
ATGATTGGGG TCCTGCTCCT
GCTCCTTCTT CTCCCTTTGC TCCTGTACAT CGCTGTACCC CAAATCAGGA AAATGCTGTC
CAGCGGGGTG TGTACATCAA CCGTCCAGCT TCCTGGGAAG GTCGCTGTGG TCACTGGAGC
CAACACAGGC ATTGGGAAGG AGACGGCCAA AGAGCTGGCT AAAAGAGGAG CCCGTGTATA
TTTAGCCTGC CGGGATGTGC AAAAGGGGGA ATCGGTGGCC AGAGAAATCC AGAACATGAC
AGGAAACCAA CAGGTATTGG TGCGGAAACT GGACCTGGCT GATACTAAAT CTATTCGAGC
TTTTGCTAAG GGCTTCTTAG CAGAAGAAAA GCATCTCCAC ATTTTGATCA ACAATGCAGG
AGTGATGATG TGTCCTTACT CCAAGACAGC AGACGGCTTT GAGACGCACA TGGGAGTCAA
CCACTTAGGT CACTTCCTCC TGACCCATCT GTTACTAGAG AAGCTGAAGG AATCAGCCCC
ATCAAGGGTA GTGAATGTGT CTTCCTTAGC ACATCACATG GGAAGGATCC ACTTCCATAA
CCTGCGGGGT GAGAAGTTCT ACCATGCGGG TCTGGCCTAC TGTAACAGCA AGTTAGCCAA
TGTTCTCTTC ACCCAGGAAC TGGCCCGGAG GCTAAAAGGC TCTGGCGTTA CAACATACTC
AGTACACCCT GGCACAGTTG ACTCTGAATT GGTTCGGCAC TCATCCCTCC TGAGATGGAT
TTGGTGGCTT TTCTCCTTCT TCATCAAGAC CCCTCAGCAG GGAGCCCAGA CCAGCCTGTA
CTGTGCCTTA ACAGAAGGTC TTGAGGTTCT AAGTGGAAAC CATTTCAGTG ACTGCCATGT
GGCATGGGTC TCTGCCCAGG CTCGTAACGA GACAGTAGCA AGGCGGCTAT GGGATGTCAG
CTGTGACCTG CTGGGCATCC CTATGGATTG ACGGGTGATG GCAGTTGGAC CAAGAGAAGC
CTGCAGCACA CTACTCAGTA CTCCCTGCCA AAATGATTCT CCTTCAGGAT GGCCAAAACC
TTGAGCACAA AGACTGCAAA CCTTCCATCC TTGCCTGCTT GATGTTGGAT AAAAGCCCAG
TGTACACTGC CAGACTCATC TAAACGCCTT GCATTTGTCT AGATTTATTT TGTTCCTATT
ACTGCCAGAG TTACCAGAGA TAATGTAGGA TAGGTGGACC CTCATATGCC TGCCACCATA
TGACCGCTTG TATTTTCCCT CTGAAACCTA CTACCTAGGA GAGCCTAAGC TATGGCAGGG
TTGATTTACA GCACTTTAGA TTTGTTTCTG TCCTTCTTGT CCACAATGTA GTTCCTCTCG
ACCAAACAAC CTTCAAAGGG GCCACGCTGC AGCCTCAGCT AAGCTCCAGG AGTCACAGTG
GCTTGGCTCA AGAGCAAGAT TTCTCCCTTA TCTCTTAAGA AAACCATCAT GGCACCAACA
TCTGGAGTCT TGAAAGAAAC TCTTAACTGA ATCTGGGTTG TGGCATGGCT TTATCTCTGA
CACCGCTTTT AAGACACTTT CCCATGCCTA GACCACAAAA GAGCTTCCTT TTCTAAGAAG
GTAGTAGGGT TTAGGGGATG GTAGGAATTT GGGGGAAGGC AGAGATAAAA ATCAAATTGA
AACTGTCATT CATTTTTCTA TTTCTCAAAC CAGCAAGAGG GTAGTGGAAG AAGCAGTTTG
CAAAGATATG CCACCTGACT TCAATTACTG AAGGAGGCCT CATTTTTGTG CCTTAGTTTC
TCTTAGAGAA CCAGAAGACA GGAAAGGCTT TTTGATGATT GTCCCTGAGT GTATCTTTGT
GTGTGTTCTT TTATATTTAT GCAGTTGGGA GCATTCAAAA TAGCCACAAA GGAACAGTAT
TATACTGGAT CCTAGTGCAG GTAAATGATC AGAGACCGAT CAAATCAGTG TCATTCAGTC
TTTGATACAA ATGGGTAGAG CTACAAATAG AAGTGAACTT TGTATCTGCT CAGAACTACC
AATCAGGAAG CACATGGGTA GCATGGAAGA AATCCAAAAA AGAATCCTAG AAGATACTGC
ATGCAAAGGC AATGAAGGGA CTAGTTAAGG GTTTGTTTTT CAGTCCCGGG CCAGGGATTG
AATCCGAACT ACAGCTGTGG CAACACTGGA TCCTTTAACC CACTGCGCCT GGCTGGGGAT
AGAACCTGAG CTTCCACAGC AACCTAAACT ACTGCAGTCA GGTTCTTAAC CCACTGCGCC
ACAGCACGAA CTTCTTCAAC AAAATATTTT AAGGACTGGT GTTGGTAATT ACAGTCAATT
TAAAAAATCT TTTAGGGCAT TTCCTTACAT TATCTTGATA TTAATGTCTA CTGTACTTGC
TAGAAATCTA CATTTGGAGA ACTTTTATCA AAAGGAATGC TGCTGAAGGA AGGCTGAGGA
ATTGGTAATA GTTCATCCCC TGTTTTGAGT ACATACTTCT ACTAGAGTTT GTGATTTTCT
TGGACTAACA TATATTCACT TAGGTGGAGA AAAGAGTGTA GGACCACAGT CTTCTCATAT
TTGTAAATAA TCTTTTGTTG AACTTGTTTT GACCATTAAA CTAGACATAG TTATTTTACG
GAAAAATTGG GAAACTTTTG ATAATAGTGT GGAACTGAAT TAATATTTAA TGTATATTGA
ACTGTCAATC ACAAATAAAA ACTTTTGATT ATGAAAAAAA AAAAAAAAAA

Deduced amino acid sequence:  (length: 316) [FASTA format sequence]
MIGVLLLLLL LPLLLYIAVP QIRKMLSSGV CTSTVQLPGK VAVVTGANTG IGKETAKELA
KRGARVYLAC RDVQKGESVA REIQNMTGNQ QVLVRKLDLA DTKSIRAFAK GFLAEEKHLH
ILINNAGVMM CPYSKTADGF ETHMGVNHLG HFLLTHLLLE KLKESAPSRV VNVSSLAHHM
GRIHFHNLRG EKFYHAGLAY CNSKLANVLF TQELARRLKG SGVTTYSVHP GTVDSELVRH
SSLLRWIWWL FSFFIKTPQQ GAQTSLYCAL TEGLEVLSGN HFSDCHVAWV SAQARNETVA
RRLWDVSCDL LGIPMD


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 [Homo sapiens]. 534e-151O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 417e-116
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 isoform 1 [Homo sapiens]. 2491e-65
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Homo sapiens]. 2283e-59
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 isoform 2 [Homo sapiens]. 68.92e-11


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRdh11retinol dehydrogenase 11 [Mus musculus]. 490e-138O
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 392e-109
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 2504e-66
Contig/Assembly ProteinRdh14retinol dehydrogenase 14 [Mus musculus]. 2273e-59
Contig/Assembly ProteinDhrs9dehydrogenase/reductase SDR family member 9 precursor [Mus musculus]. 60.19e-09


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480366PREDICTED: similar to Retinol dehydrogenase 11 (Retinal reductase 1) (RalR1) (Prostate short-chain dehydrogenase/reductase 1) (Androgen-regulated short-chain dehydrogenase/reductase 1) (HCV core-binding protein HCBP12) [Canis familiaris]. 510e-144O
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 415e-115
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 2536e-67
Contig/Assembly ProteinLOC491173PREDICTED: similar to retinol dehydrogenase 11 (predicted) [Canis familiaris]. 2307e-60
Contig/Assembly ProteinLOC482983PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis) isoform 3 [Canis familiaris]. 62.82e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH11PREDICTED: retinol dehydrogenase 11-like [Bos taurus]. 541e-154O
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Bos taurus]. 416e-116
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 [Bos taurus]. 2552e-67
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 [Bos taurus]. 1131e-24


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 575e-164
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 417e-116
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 2267e-59
Contig/Assembly ProteinLOC100513982PREDICTED: retinol dehydrogenase 12-like [Sus scrofa]. 1037e-22
Contig/Assembly ProteinLOC100626199PREDICTED: retinol dehydrogenase 16-like isoform 1 [Sus scrofa]. 58.23e-08


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-125074.1GTGGAGAAAAGAGTGTAGGACCACAGTCTTCTCATATTTGTAAATAATCTTTTGTTGAAC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0033699fwd
2003082620030826C-00069610fwd
2004020420040204C-0045448fwd
2005032220050322C-00114611fwd
2006061120060611C-00115714fwd
2007080620070806C-00135514fwd
2008051520080515C-00241118fwd
2010100120101001C-00229814fwd
2011060120110601C-01297414fwd