[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRM1_0082_H02

Library: OVRM1 (Ovary)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 1,617)  [FASTA format sequence]
GAGACCTGGC AGGGATTTGG GACGCTGGAC AGGCAGTTTC TTCACGTAGC CAGAGTGCGA
ACGTGGGGTG CAAAACGGGT CCTTTGCGGC GCGGTGGGTT CGGGGCCCTG GCAGCCGTTT
TGCGGAGGTG CCACGCCCTA GGGGCTGGGC CGTGGTGGGC CCGGGGTCTA CTCCGACCAC
CTGGACCGCG AAGTGGCCTG GGAACTGGAA GGAAG
ATGTT CCCCGGGCGC TGTCCGCCGC
CCGCGCTACT GGGCCGAGGT CCCCATCTCA ACGTAGATTC TCTTTTTCCC CTCTTCTGCA
GGCTCGTTTC TGGCATGATG GCGCAAAGGG CCTTCCCGAA TCCTTATGCA GATTTTAACA
AATCCCTGGC CGAAGGCTAC TTTGATTCTG CTGGGAGGCT CACTCCTGAG TTCTCACAAC
GTGTGAACAA TAAGATTCGA GAGCTGCTTC AGCAAATGGA GAGAGGCCTA AAATCAGCAG
ACCCTCGCGA TGGCACTGCT TACACTGGAT GGGCAGGTAT CGCTGTGCTT TACTTACACC
TCTATGATGT GTTTGGGGAC CCTGCCTACC TGCAGATGGC ACATGGCTAT GCAAAGCAAA
GTCTGAACTG TTTGACCAAG CGTTCCATCA CCTTCCTGTG TGGTGATGCG GGCCCCCTGG
CAGTGGCTGC TGTGGTGCAT GACAAGATGA ACAATGAGAA GCAGGCAGAA GACTGTATCA
CCCGGCTAAT TCACCTAAAT AAGATTGACC CGCATGCTCC AAATGAAATG CTGTATGGAC
GAATGGGCTA CATCTATGCT CTTCTCTTTG TGAATAAGAA CTTTGGAGTA GAAAAGATTC
CTCGAAGCCA TATTCAGCAG ATTTGTGAAA CAGTCTTAAC CTCTGGAGAA AACCTAGCTA
GAAAAAGAAA CTTCACAGAA AAAACTCCAC TGATGTATGA ATGGTACCAA GAATATTATG
TGGGGGCTGC TCATGGCCTG GCAGGAATTT ATTACTACCT GATGCAGCCC AGCCTTCAAG
TGAGCCATGC GAAGTTACAG AGTTTGGTCA AGCCTAGTGT AGATTATGTC TGCCAGCTGA
AATTCCCTTC AGGCAATTAC CCTCCTTGTG TGGACGACAC TCGAGATCTG CTAGTCCATT
GGTGCCACGG TTCCCCTGGG GTAATCTACA TGCTCATTCA GGCCTATAAG GTGTTCAGAG
AAGAACGGTA TCTCAATGAT GCCTACCAGT GTGCCGATGT GATCTGGAAG TACGGGTTGC
TGAAGAAGGG GTACGGGCTG TGCCACGGCA CTGCGGGGAA CGCCTATGCC TTCCTGACCC
TGTTCAACCT CACGCAGGAC ATGAAGTACC TATATAGGGC TTGTAAGTTT GCTGAGTGGT
GTCTAGATTA TGGAGAACAT GGATGCAGAA CACCGGACAC TCCTTTCTCC CTCTTTGAAG
GAATGGCTGG AACAATATAT TTCCTGGCTG ACCTGCTAGT GCCCACAAAA GCCAAGTTCC
CTGCATTTGA ACTATAAAAG GAGAGTCTGC CCCCTGCAAC TCACTGCATG AGCATTTCTG
TATATCAAAC CATGATTAAA GCAACAGTAG AATCAAACTA AAAAAAAAAA AAAAAAA

Deduced amino acid sequence:  (length: 433) [FASTA format sequence]
MFPGRCPPPA LLGRGPHLNV DSLFPLFCRL VSGMMAQRAF PNPYADFNKS LAEGYFDSAG
RLTPEFSQRV NNKIRELLQQ MERGLKSADP RDGTAYTGWA GIAVLYLHLY DVFGDPAYLQ
MAHGYAKQSL NCLTKRSITF LCGDAGPLAV AAVVHDKMNN EKQAEDCITR LIHLNKIDPH
APNEMLYGRM GYIYALLFVN KNFGVEKIPR SHIQQICETV LTSGENLARK RNFTEKTPLM
YEWYQEYYVG AAHGLAGIYY YLMQPSLQVS HAKLQSLVKP SVDYVCQLKF PSGNYPPCVD
DTRDLLVHWC HGSPGVIYML IQAYKVFREE RYLNDAYQCA DVIWKYGLLK KGYGLCHGTA
GNAYAFLTLF NLTQDMKYLY RACKFAEWCL DYGEHGCRTP DTPFSLFEGM AGTIYFLADL
LVPTKAKFPA FEL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL1lanC-like protein 1 [Homo sapiens]. 7900.0O
Contig/Assembly ProteinLANCL2lanC-like protein 2 [Homo sapiens]. 475e-134
Contig/Assembly ProteinLANCL3lanC-like protein 3 isoform 2 [Homo sapiens]. 2064e-53


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLancl1lanC-like protein 1 [Mus musculus]. 7540.0O
Contig/Assembly ProteinLancl2lanC-like protein 2 [Mus musculus]. 484e-137
Contig/Assembly ProteinLancl3lanC-like protein 3 [Mus musculus]. 2071e-53


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC478897PREDICTED: similar to LanC-like protein 1 (40 kDa erythrocyte membrane protein) (p40) [Canis familiaris]. 7810.0O
Contig/Assembly ProteinLOC483240PREDICTED: similar to LanC-like protein 2 (Testis-specific adriamycin sensitivity protein) [Canis familiaris]. 471e-133O
Contig/Assembly ProteinLOC491823PREDICTED: similar to LanC lantibiotic synthetase component C-like 3 [Canis familiaris]. 2073e-53O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL1lanC-like protein 1 [Bos taurus]. 7750.0O
Contig/Assembly ProteinLANCL2lanC-like protein 2 [Bos taurus]. 478e-135O
Contig/Assembly ProteinLANCL3lanC-like protein 3 [Bos taurus]. 2041e-52


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100153701PREDICTED: lanC-like protein 1 [Sus scrofa]. 8910.0
Contig/Assembly ProteinLOC100620078PREDICTED: lanC-like protein 2-like, partial [Sus scrofa]. 463e-130
Contig/Assembly ProteinLOC100626898PREDICTED: lanC-like protein 3-like [Sus scrofa]. 1825e-46
Contig/Assembly ProteinLOC100625232PREDICTED: lanC-like protein 1-like [Sus scrofa]. 1295e-30


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-128054.1CTCACTGCATGAGCATTTCTGTATATCAAACCATGATTAAAGCAACAGTAGAATCAAACT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0006219fwd
2003082620030826C-00076810fwd
2004020420040204C-0007103fwd
2005032220050322C-0008503fwd
2006061120060611C-0008223fwd
2007080620070806C-0009743fwd
2008051520080515C-0018904fwd
2010100120101001C-0071405fwd
2011060120110601C-0010155fwd