[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRM1_0114_A04

Library: OVRM1 (Ovary)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 2,009)  [FASTA format sequence]
CGTGCCCGCC GGACCTGCAA ACTTGTGCCA CCGGCTCTGC CTGTCCCCAG GGAGCCCGAG
CGTCCGCGGC CCTCGCCCCT CCCGCCCGTC ACCAGCC
ATG GGCTGCTTCG AGTGCTGCAT
CAAGTGTCTG GGAGGAGTCC CCTACGCCTC CCTGGTGGCC ACCATCCTCT GCTTCTCGGG
GGTGGCCTTG TTCTGCGGCT GTGGGCATGT GGCCCTGGCG GGCACCGTGG CCATCCTGGA
GCAGCACTTC TCCACCAACA CCAGTGACCA TGCCCTGCTG AGCGAGGTAA TCCAACTGAT
GCAGTACGTC ATCTACGGCA TCGCGTCCTT CTTCTTCTTG TACGGGATCA TCCTGTTGGC
AGAGGGCTTC TACACCACCA GCGCAGTCAA GGAGCTGCAC GGCGAGTTTA AGACAACCGC
CTGTGGCCGC TGCATCAGCG GGATGTTTGT CTTCCTCACC TACGTGCTGG GAGTGGCCTG
GCTGGGCGTG TTCGGTTTCT CCGCGGTGCC GGTGTTCATG TTCTACAACA TATGGTCCAC
CTGTGAAGTC ATCAAGGCCC CCCAGAGCAA CGGGACAGCC GGGGTGGAGC AGATCTGTGT
GGACATCCGG CAATACGGCA TCATCCCTTG GAACGCCTTC CCCGGAAAAA TATGTGGCTC
TGCCCTGGAG AACATCTGCA ACACCAACGA GTTCTACATG TCCTACCACC TGTTCATCGT
GGCCTGTGCG GGAGCTGGCG CTACCGTCAT CGCCCTGATC CACTTCCTCA TGATACTGTC
TTCTAACTGG GCTTACTTAA AGGATGCAAG CAAAATGCAG GCTTACCAGG ATATCAAAGC
AAAGGAAGAA CAGGAACTGC AAGATATCCA GTCTCGGTCA AAAGAACAAC TCAATTCTTA
CACATAAAGG TCTGCCAGAG GGTCTCAGCC GACGAGTTGA CAGCTCTGAC AAATCACCAG
ACAGCTGCTC TGCAGTCCAG ATGTGTTCCC CACCCAACAA ACTCATGTAC CAGTCCCAAC
ACTTCATTGT CTGTCTCAAG CTGCCAGGAT GTGTTTCTAG GAAAACCTTC CAGTACGTAA
ATCTTTTCCT TTAGAACAGA TATCGGAGGT GTCACGTGAG CCATTTTAAA AGGCAACACT
TTGACAAAAT GATGGTTCAT CCTTTTGAAC CTTGTGGCAT GTTCGCATCC ATCCCTAGAG
CAAATCGGCC AAGACGCCCG CAGAAGATGG CATAGACCTT GACACGGGCC CGTGGTGCGC
CAGCATCAAG CGAAATGGCC ACCAGTTCAC AGATGCCATC TGTCCTCACA TCCACGTATC
TAAATAGGGA ATAAAATACA GTTGAGGTGA CGTTCCAGTT CTCACAGCTG ACGTTTATTA
AACTGGCTCA GGGATACGTG AGCCTTACGA TGGACCTTTA AAAAAATTTG GCTGATTCCC
CCAGTCCAGG ACATATTAAT TTCCTGAACT ACTCAGAAAT CTTTTTTCCA AGAATGCTCA
AGCGAGCCTG CTAGAGTAAT TCTACTACAC CTACCATGGA AAAAGCTGGA TTCCAACTGT
GTCAGGCTGT CCAGAATCAA TTTTATAATA GGTTTCATTG TAATAAAGTG ACCCAATTGT
CATCATTCTT CTTGAGAAAG CAATGTCAGC TCAATGTCAG CTCTGCCTTA ATGAGTATTT
GCTTTAAATT TCTAAGAACT TAAGTTACAA CAGGCTACCC CAAATCCTTC ATAAAATTTT
GTTCCACCAA TGTTTTTTTT TTTCCTTAAG AAGTGTTACC TTGTTAAAAT GACCACCACT
CTCAACCATT TTTATGTGGT CTGAATAGTG AGTTTACAGT TTCATACCAA CTATCTACAA
CTTAATTACA ACTAGACCAC AGACCTCCTA CTTTTATAGA CTTGAATACT TTAGGTAGGG
TTGGTATTTA TTTCACTTTT TCTTACCTAA ATCTTAGTTT CCTGGGAATA ATAAAATTCA
ATGTTCGGCA AAAAAAAAAA AAAAAAAAA

Deduced amino acid sequence:  (length: 269) [FASTA format sequence]
MGCFECCIKC LGGVPYASLV ATILCFSGVA LFCGCGHVAL AGTVAILEQH FSTNTSDHAL
LSEVIQLMQY VIYGIASFFF LYGIILLAEG FYTTSAVKEL HGEFKTTACG RCISGMFVFL
TYVLGVAWLG VFGFSAVPVF MFYNIWSTCE VIKAPQSNGT AGVEQICVDI RQYGIIPWNA
FPGKICGSAL ENICNTNEFY MSYHLFIVAC AGAGATVIAL IHFLMILSSN WAYLKDASKM
QAYQDIKAKE EQELQDIQSR SKEQLNSYT


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGPM6Bneuronal membrane glycoprotein M6-b isoform 1 [Homo sapiens]. 545e-155O
Contig/Assembly ProteinPLP1myelin proteolipid protein isoform 1 [Homo sapiens]. 2682e-71


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGpm6bneuronal membrane glycoprotein M6-b isoform 4 [Mus musculus]. 550e-156O
Contig/Assembly ProteinGpm6aneuronal membrane glycoprotein M6-a [Mus musculus]. 3142e-85O


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC480842PREDICTED: similar to glycoprotein M6B isoform 2 [Canis familiaris]. 462e-130O
Contig/Assembly ProteinLOC475641PREDICTED: similar to glycoprotein M6A isoform 1 isoform 2 [Canis familiaris]. 3342e-91O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGPM6Bneuronal membrane glycoprotein M6-b [Bos taurus]. 463e-130O
Contig/Assembly ProteinGPM6Aneuronal membrane glycoprotein M6-a [Bos taurus]. 3128e-85
Contig/Assembly ProteinPLP1myelin proteolipid protein [Bos taurus]. 2705e-72


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100155237PREDICTED: neuronal membrane glycoprotein M6-b isoform 1 [Sus scrofa]. 551e-157
Contig/Assembly ProteinLOC100622539PREDICTED: neuronal membrane glycoprotein M6-a-like [Sus scrofa]. 3133e-85
Contig/Assembly ProteinLOC100511106PREDICTED: neuronal membrane glycoprotein M6-a-like isoform 1 [Sus scrofa]. 3101e-84


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-131644.1CACAGACCTCCTACTTTTATAGACTTGAATACTTTAGGTAGGGTTGGTATTTATTTCACT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531S-0113521fwd
2003082620030826S-0213591fwd
2004020420040204S-0213141fwd
2005032220050322S-0293971fwd
2006061120060611S-0366331fwd
2007080620070806S-0584231fwd
2008051520080515C-0026965fwd
2010100120101001C-00186828fwd
2011060120110601C-01253328fwd