[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRM1_0164_G05

Library: OVRM1 (Ovary)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 3,882)  [FASTA format sequence]
ATTTTTTTTC CCGCGAAACT CAGCGGAGGA CCGTGGGGGC TTGTGAATCT CTGGTTCCGG
GAAACGCGGG AAGGGAGAGG TGCAGTC
ATG TCAGGCTTCG ACGACCCCGG CATTTTCTAC
AGCGACAGCT TCGGCGGGGA CAACGCTGCC GATGAGGGGC AGGCCCGCAA GTCGCAGCTG
CAGAGGCGCT TCAAGGAGTT CCTGCGGCAG TACCGCGTGG GCACCGACCG CACCGGCTTC
ACCTTCAAGT ACAGGGATGA ACTCAAGCGG CATTATAACC TGGGGGAGTA TTGGATCGAG
GTGGAGATGG AGGACCTGGC CAGCTTCGAC GAGGACCTGG CCGACTACCT GTACAAGCAG
CCAGCTGAGC ATTTGCAGCT GCTGGAGGAA GCTGCTAAGG AGGTGGCTGA TGAGGTGACC
CGGCCCCGGC CCACTGGCGA TGAGGTGCTC CAGGACATCC AGGTCATGCT CAAGTCGGAC
GCCAGCCCGT CCAGCATCCG GAGCCTGAAG TCGGACACGA TGTCACACCT GGTGAAGATC
CCGGGCATCG TCATCGCCGC CTCCGGGGTC CGCGCCAAGG CCACCCGCAT CTCCATCCAG
TGCCGCAGCT GCCGAAACAC CCTCACCAAC ATCGCCATGC GCCCCGGCCT GGAGGGCTAC
GCCCTGCCCA GGAAGTGCAA CACGGATCAG GCCGGGCGCC CCAAGTGCCC GCTGGACCCG
TACTTCATCA TGCCCGACAA GTGCAAGTGT GTGGACTTCC AGACCCTGAA GTTGCAGGAG
CTGCCGGACG CGGTGCCTCA CGGCGAGATG CCCAGACACA TGCAGCTCTA CTGCGACAGG
TACCTGTGTG ACAAGGTCGT CCCTGGAAAC AGGGTCACCA TCATGGGCAT CTACTCCATC
AAGAAGTTTG GCCTGACCTC CAACAGGGGC CGCGACAGGG TGGGCGTGGG CATCCGGAGC
GCCTACATCC GGGTCCTGGG CATCCAGGTG GACACGGATG GCTCTGGCCG CAGCTTTGCC
GGGGCCGTGA CCCCGCAGGA GGAGGAGGAG TTCCGGCGGC TGGCCGCCCT CCCCAACGTC
TACGAGGTCG TCTCCAAGAG CATCGCCCCC TCCATCTTCG GGGGCACGGA CATGAAGAAG
GCCATCGCCT GCCTGCTCTT CGGGGGTTCC CGAAAGAGGC TCCCCGACGG CCTCACTCGC
CGAGGAGACA TCAACCCGCT GATGGTGGGG GACCCGGGGA CGGCCAAGTC CCAGTTGCTG
AAGTTTGTGG AGAAGTGCTC TCCCATCGGG GTGTACACGT CTGGGAAGGG CAGCAGCGCG
GCTGGCCTGA CCGCCTCGGT GATGAGGGAC CCCTCGTCCC GGAACTCCAT CATGGAGGGC
GGGGCCATGG TCCTGGCCGA TGGCGGTGTC GTCTGTATCG ATGAGTTTGA CAAGATGCGC
GAAGACGACC GTGTGGCGAT CCACGAGGCC ATGGAGCAGC AGACCATCTC CATTGCCAAG
GCCGGCATCA CCACCACCCT CAACTCGCGC TGCTCCGTCC TGGCCGCCGC CAACTCGGTG
TTCGGCCGCT GGGATGAGAC GAAGGGGGAG GACAACATCG ACTTCATGCC CACCATCCTG
TCGCGCTTCG ACATGATCTT CATCGTCAAG GACGAGCACA ACGAGGAGAG GGACGTGATG
CTGGCCAAGC ATGTCATCAC TCTGCACGTG AGCGCACTGA CGCAGACCCA GGCCGTGGAG
GGCGAGATCG ACCTGGCCAA GCTGAAGAAG TTCATCGCCT ACTGCCGCGC GAAGTGTGGT
CCCCGGCTGT CGGCCGAGGC CGCAGAGAAG CTCAAGAACC GGTACATCAT CATGCGGAGC
GGGGCCCGTC AACACGAGAG GGACAGCGAC CGCCGCTCCA GCATCCCCAT CACCGTGCGG
CAGCTGGAGG CCATCGTGCG CATCGCTGAG GCCCTCAGCA AGATGAAGCT GCAGCCCTTC
GCCACGGAGG CGGACGTGGA GGAGGCCCTG AGGCTCTTCC AAGTGTCCAC GCTGGACGCC
GCCTTGTCGG GCACCCTGTC AGGGGTGGAG GGCTTCACCA GCCAGGAGGA CCAGGAGTTG
CTGAGCCGCA TTGAGAAGCA GCTCAAGCGC CGCTTTGCCA TCGGCTCCCA GGTGTCGGAG
CACAGCATCA TCCAGGACTT CACCAAGCAG AAGTACCCGG AGCACGCCAT CCACAGGGTT
CTGCAGCTCA TGCTGCGGCG GGGCGAGCTC CAGCATCGCA TGCAGCGCAA GGTCCTCTAC
CGCCTCAAGT GAGCTGCACC ACCCGCCGCA GGAAGCCACC GCTACCACCT CGAACCCTGT
CCTGCACACT CTCGCTGCTA GGTACCTCCC TCGGCTGCTG ATCCAAGAAA CGTGCTTTTG
AAGTCACTGA AGTAATAAAG CCATGATGTG TTTGGATATC CGTGGGCTTT GGCACAGGGT
GGCCTGTCAC CCCTATCTGA CCCTCACGGC TGGGCGGGTC TTGGCAAAGA CAGGCTTTGG
AGCCTGCAGG CCTGGGTTTG TGACCCGCCT CTGCCACTTG GGCTGCTGGG CGAGGCGCTC
ACCTTTGTGC TCGGGTTCTG CAGCGGCGGT GGGGTCCAGC CCGCTTCTCC CTGGCGCTGG
GGAGAACTTG AGTTCCGCAA GGTCTGGCGT GCACAGAGTG TCAGTTCTCA CCTCTGCTCT
TCTCCGGCCA CTTCGTGTGC TGGCAAGAAT CATGGTTTGC ATCAGACTGG CTGGGTCCCC
TGAACCTTTC TGTGCCTCAG TCTGTAAATG GGGGAGACTT CATGCCTCCT TCGCGGGGTT
GCATTTAACG GGAGTGAGCT GCTGGTAGTG GGTGTCCAGG AAGAGGCAGG CAGCATGGCG
ACACTGATGG CCTTTGGATC TGGGGCCATG GACTCCCACC GGGCCTTGAG CAAGAGAGGG
GTGCTCTCTT GCTCACATTT GGTAGGCCCG GCCTCCCCTG CAGGCCACCC ACAAGCTATG
TGGCCTTGGG CGAGGCGCCT GACCCTTCTG GGCCTGAGGT TGTATTTTTT TTGTGTGTTT
TTAGGGCCGC AACCATGGAG TATAGAGGTT CCCAGGCTAG GGGTAGAATC AGAGCTACAG
CTGTCAGCCT ACAGCACAGC CACAGCAAGG CAGGATCCGA GCTGCATCTG TGATCTACAC
CACAGCTCAC GGCAATGCCA GATCCTTAAC CCACTGAAAT GAGGTCAGGG ATCAAACCCG
CATCCTCATG GATACTAGTC GGGTTCATTA CTACAGAGCC ACGATGGGAA CTCCCTATAC
AGAAATTTTC TAGTGCTGTA GTCCCACTTG TTCGTTTTTT TGCTTTGGTA TCAAAATCCA
AAAAATTATC ACCGAGACTG ATGTCAGCGA GCTTACTGCC TGTTTTCTTC AAGGAATGTT
AATGATTTCA GGCCTCATGT GTAAACTCCT GAGTTAATGT TTTGTGTGTG GTCTGAGATG
GTGGTTCTCC TTCATTCTTT TGCGTGAGGG CTACTCAGCT TTCCCAGCAC CGTTTGTTGA
AAGAGACTGT CCTTTCTCCG TGGTTCTTGG CTCCTTTGTT GTTTCTTTCT TTCTTTTTTT
TTTTTTTTCC TTAAGTTTAT TGAAGTCTAG TTGCTTTACA AGGTTGTGAT AATTTCTGCT
GCACAACAAA GTGATTCAGT CACACATCAC ATGTATTCAC TCTCTTGCCA CGTAGATGGT
CACAGAGTAC CAGGTGGAGT TCCCTGTGCT GCACAGCAGG TCCCCCTTGG CCAATACACC
TCAGTGTGCA TATGCCAATC CCAGACCGCC AGCCCCTTCC TCGCCCACCC CTTCGTTGTG
AATTAATTGA CCGTATCTAA GTAAAAAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 734) [FASTA format sequence]
MSGFDDPGIF YSDSFGGDNA ADEGQARKSQ LQRRFKEFLR QYRVGTDRTG FTFKYRDELK
RHYNLGEYWI EVEMEDLASF DEDLADYLYK QPAEHLQLLE EAAKEVADEV TRPRPTGDEV
LQDIQVMLKS DASPSSIRSL KSDTMSHLVK IPGIVIAASG VRAKATRISI QCRSCRNTLT
NIAMRPGLEG YALPRKCNTD QAGRPKCPLD PYFIMPDKCK CVDFQTLKLQ ELPDAVPHGE
MPRHMQLYCD RYLCDKVVPG NRVTIMGIYS IKKFGLTSNR GRDRVGVGIR SAYIRVLGIQ
VDTDGSGRSF AGAVTPQEEE EFRRLAALPN VYEVVSKSIA PSIFGGTDMK KAIACLLFGG
SRKRLPDGLT RRGDINPLMV GDPGTAKSQL LKFVEKCSPI GVYTSGKGSS AAGLTASVMR
DPSSRNSIME GGAMVLADGG VVCIDEFDKM REDDRVAIHE AMEQQTISIA KAGITTTLNS
RCSVLAAANS VFGRWDETKG EDNIDFMPTI LSRFDMIFIV KDEHNEERDV MLAKHVITLH
VSALTQTQAV EGEIDLAKLK KFIAYCRAKC GPRLSAEAAE KLKNRYIIMR SGARQHERDS
DRRSSIPITV RQLEAIVRIA EALSKMKLQP FATEADVEEA LRLFQVSTLD AALSGTLSGV
EGFTSQEDQE LLSRIEKQLK RRFAIGSQVS EHSIIQDFTK QKYPEHAIHR VLQLMLRRGE
LQHRMQRKVL YRLK


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMCM5DNA replication licensing factor MCM5 [Homo sapiens]. 14170.0
Contig/Assembly ProteinMCM4DNA replication licensing factor MCM4 [Homo sapiens]. 3277e-89
Contig/Assembly ProteinMCM2DNA replication licensing factor MCM2 [Homo sapiens]. 3238e-88
Contig/Assembly ProteinMCM8DNA replication licensing factor MCM8 isoform 2 [Homo sapiens]. 2413e-63


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMcm5DNA replication licensing factor MCM5 [Mus musculus]. 13840.0
Contig/Assembly ProteinMcm2DNA replication licensing factor MCM2 [Mus musculus]. 3222e-87
Contig/Assembly ProteinMcm4DNA replication licensing factor MCM4 [Mus musculus]. 3175e-86
Contig/Assembly ProteinMcm7DNA replication licensing factor MCM7 [Mus musculus]. 3052e-82
Contig/Assembly ProteinMcm6DNA replication licensing factor MCM6 [Mus musculus]. 2906e-78


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC610519PREDICTED: similar to DNA replication licensing factor MCM5 (CDC46 homolog) (P1-CDC46) [Canis familiaris]. 11470.0
Contig/Assembly ProteinLOC484622PREDICTED: similar to minichromosome maintenance protein 2 [Canis familiaris]. 3275e-89
Contig/Assembly ProteinLOC477871PREDICTED: similar to minichromosome maintenance protein 4 [Canis familiaris]. 3221e-87
Contig/Assembly ProteinLOC479737PREDICTED: similar to DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3) isoform 3 [Canis familiaris]. 3013e-81
Contig/Assembly ProteinLOC477163PREDICTED: similar to minichromosome maintenance protein 8 isoform 1 isoform 1 [Canis familiaris]. 2452e-64


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMCM5DNA replication licensing factor MCM5 [Bos taurus]. 14260.0
Contig/Assembly ProteinMCM4DNA replication licensing factor MCM4 [Bos taurus]. 3191e-86
Contig/Assembly ProteinMCM7DNA replication licensing factor MCM7 [Bos taurus]. 3061e-82
Contig/Assembly ProteinMCM2PREDICTED: KIAA0030-like [Bos taurus]. 2976e-80
Contig/Assembly ProteinMCM8PREDICTED: minichromosome maintenance complex component 8 isoform 1 [Bos taurus]. 2461e-64


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100624915PREDICTED: DNA replication licensing factor MCM5-like, partial [Sus scrofa]. 2852e-76
Contig/Assembly ProteinMCM3PREDICTED: DNA replication licensing factor MCM3 [Sus scrofa]. 2835e-76
Contig/Assembly ProteinMCM2PREDICTED: DNA replication licensing factor MCM2 [Sus scrofa]. 2812e-75
Contig/Assembly ProteinMCM8PREDICTED: DNA replication licensing factor MCM8 [Sus scrofa]. 2435e-64
Contig/Assembly ProteinLOC100624302PREDICTED: DNA replication licensing factor MCM7-like [Sus scrofa]. 2273e-59


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-136334.1TAATTTCTGCTGCACAACAAAGTGATTCAGTCACACATCACATGTATTCACTCTCTTGCC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0011594fwd
2003082620030826C-0015424fwd
2004020420040204C-0015795fwd
2005032220050322C-0013593fwd
2006061120060611C-00670910fwd
2007080620070806C-00168110fwd
2008051520080515C-00329011fwd
2010100120101001C-00304111fwd
2011060120110601C-00355811fwd