[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRM1_0170_G05

Library: OVRM1 (Ovary)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 1,342)  [FASTA format sequence]
GAGTCCCGCG GGCGGCGCGG AAGCGGCGGC CGGGCAGCCA TGTCGCCTTT GTCTGCGGCG
CGGGCGGCCC TGCGGGTCTA CGCGGCGGGC GCGGCGGTGA TCCTGGCGCA GCTGCTGCGC
CGCTGCCGCG GGGGCTTCGC GGAGCCAGTT TTCCCGCCAC AACCCGGGCG CGTTGCCATA
GTGACCGGAG GGACGGAGGG CATCGGCTTT GCCACCGCGA AGCATCTGGC GAGACTGGGC
ATGCACGTGA TCATAGCTGG AAACAATGAC AGCAAAGCCC GGGAAGCGGT GAGGAAGATC
CGAGAGGAGA CCCTGAATGA CAAAGTGGAG TTTTTATATT GCGACCTGGC GTCCATGAAG
TCTATCCGGC AGTTTGTCCA GAAGTTCAAG ATGAAGAAAA TCCCTCTCCA CGTCCTGGTC
AATAACGCTG GCGTGATGAT GGTGCCGCAG AGGGAGACGG AGGACGGCTT CGAGGAGCAC
TTTGGAGTGA ACTACCTGGG CCACTTCCTG CTGACCCACC TCCTCCTGGA CGACCTGCAG
GCGTCGGGCT CCCCCGGCCG CAGCTCCAGG GTGGTGACCG TGTCCTCGGC CACACACTAC
GTTGGGGAGC TGGACTTGGA CGACCTCCAG AGCAGCGGCG GCTACTCCCC GCACGGCGCC
TACACCCGCA GCAAGCTGGC CCTGGTCCTC TTCTCCCACC GGCTGCAGGC GCTGCTGGAG
GCCAAGGGCA GCCCGGTGAC CGCCAACGTG GCCGACCCCG GCGTGGTCAA CACCGACCTG
TACAGACACG TCTTCTGGGG CACGCGGCTC CTCAAGAAGC TCTTCGGCTG GTGGTTTTTC
AAGACCCCGG ATGAAGGAGC CTGGACGTCT GTCTATGCTG CCGTCTCCCC GGCGCTGGAA
GGCGTGGGCG GCCGCTATCT TTACAACGAG AAGGAGGCCA AGTCACTGGC GATCACGTAC
GACCCGAAGC TTCAGCGACA GCTGTGGGCC CGGAGTTGCC AGATGACCGG CATCGCTGAC
ATGACCCGGG ACACCTTGTG GGGATAGCGG CCACGCCGGG AGGACCGCGT CGGCCCAGCG
CTCGCAGGTG CGTCTGCGCT GGACCGCGCC TCTGCGTCCT TCCCGCCGCG CCCTCCAGAC
TGTGTCGGTC CGCATCTTCC GCCGGCTGCT GCCGTGCGCT TTGCAGGAAG TGAAGAAGCA
GAGGCGGCTG TGAGTGTGGC CCTGAGCCTC TGGTCCTCAG CCCCGAATTG CCTGATTCCC
CAAAGGATCG ACGGTGCCGG GTGCCCTGTG TCATTAAATC CTGCCAGCCC CGTGAAAAAA
AAAAAAAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 335) [FASTA format sequence]
MSPLSAARAA LRVYAAGAAV ILAQLLRRCR GGFAEPVFPP QPGRVAIVTG GTEGIGFATA
KHLARLGMHV IIAGNNDSKA REAVRKIREE TLNDKVEFLY CDLASMKSIR QFVQKFKMKK
IPLHVLVNNA GVMMVPQRET EDGFEEHFGV NYLGHFLLTH LLLDDLQASG SPGRSSRVVT
VSSATHYVGE LDLDDLQSSG GYSPHGAYTR SKLALVLFSH RLQALLEAKG SPVTANVADP
GVVNTDLYRH VFWGTRLLKK LFGWWFFKTP DEGAWTSVYA AVSPALEGVG GRYLYNEKEA
KSLAITYDPK LQRQLWARSC QMTGIADMTR DTLWG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRSXdehydrogenase/reductase SDR family member on chromosome X precursor [Homo sapiens]. 454e-128O
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Homo sapiens]. 1665e-41
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 isoform 1 [Homo sapiens]. 1625e-40
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 1565e-38
Contig/Assembly ProteinDHRS2dehydrogenase/reductase SDR family member 2 isoform 2 [Homo sapiens]. 53.93e-07


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDhrsxdehydrogenase/reductase SDR family member on chromosome X homolog precursor [Mus musculus]. 3141e-85O
Contig/Assembly ProteinRdh14retinol dehydrogenase 14 [Mus musculus]. 1695e-42
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 1627e-40
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 1555e-38
Contig/Assembly ProteinCbr1carbonyl reductase [NADPH] 1 [Mus musculus]. 50.82e-06


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC609792PREDICTED: similar to dehydrogenase/reductase (SDR family) X-linked [Canis familiaris]. 444e-125O
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 1673e-41
Contig/Assembly ProteinLOC482983PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis) isoform 1 [Canis familiaris]. 1642e-40
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 1602e-39
Contig/Assembly ProteinLOC487748PREDICTED: similar to carbonyl reductase 3 [Canis familiaris]. 61.62e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinDHRSXPREDICTED: dehydrogenase/reductase (SDR family) X-linked [Bos taurus]. 3263e-89O
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Bos taurus]. 1672e-41
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 [Bos taurus]. 1611e-39
Contig/Assembly ProteinMGC152281hypothetical protein LOC507942 [Bos taurus]. 1151e-25


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 1632e-40
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 1586e-39
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 1571e-38
Contig/Assembly ProteinLOC100513982PREDICTED: retinol dehydrogenase 12-like [Sus scrofa]. 79.34e-15
Contig/Assembly ProteinLOC100512990PREDICTED: carbonyl reductase [NADPH] 3-like [Sus scrofa]. 55.57e-08


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-136934.1AGTTTGTCCAGAAGTTCAAGATGAAGAAAATCCCTCTCCACGTCCTGGTCAATAACGCTG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0022882fwd
2003082620030826C-0013675fwd
2004020420040204C-00090911fwd
2005032220050322C-00115013fwd
2006061120060611C-00658213fwd
2007080620070806C-00809413fwd
2008051520080515C-00284415fwd
2010100120101001C-00286915fwd
2011060120110601C-00846215fwd