[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRT1_0146_C03

Library: OVRT1 (Ovary)
Individual: D2-14C, Duroc

Nucleotide sequence:   (length: 1,362)  [FASTA format sequence]
TAGGATTCTG GGCTACGCTG AGAGCCAGGC TGTTGCTGAG CACCCAGGAT CGAGAAGAGG
CAGAGGAAAG GGAAGCAGAG AGAAGCAGCC AAGAGTTGGA GCCAGACCAG GAGGAGCCCG
AGTGGAGTTG AAGTTCCTTT TGCAGAGGCG GCAGCAAGTA AAGCAGTTGA AACGATGCTG
GCTGTCTTGG GACTGCTCAC CTCCTTCCTT TTTTTTCCTG TATGTGACAG CTCCATCCAT
CAGGAAGTTC TTTGCTGGTG GGGTTTGTAG GACAAAC
ATG CAGCTTCCCG GGAAGGTGGT
GGTGATCACG GGTGCCAACA CGGGCATTGG CAAGGAGACA GCCAGAGAGC TCGCTCGCAG
AGGAGCCCGA GTATACATTG CCTGCCGAGA TGTACTGAAG GGGGAGTCTG CTGCCAGTGA
GATCCGAGCT GATACAAAGA ACTCCCAGGT GCTGGTGCGG AAACTGGACC TCTCTGATAC
CAAATCCATC CGAGCCTTTG CTGAGGGCTT TCTGACAGAG GAAAAGCAGC TCCATATTCT
GATCAACAAT GCTGGAGTGA TGTTGTGTCC ATATTCCAAG ACAGCGGATG GCTTTGAGAC
CCACCTGGGA GTCAACCACC TGGGCCACTT CCTTCTCACG CACTTGCTCT TGGAGCAGCT
GAAGGCATCT GCTCCCGCAC GGGTGGTGAA CCTGTCATCC GTGGTCCACC ATGCTGGCAA
GATTCGCTTC CACGACCTCC AGGGTGAGAA GCACTACAAC CGGGGTTTTG CTTATTGCCA
CAGCAAGCTG GCCAACGTGC TCTTTACTCG GGAACTGGCC AAGAGGCTCC AAGGCACGGG
GGTCACCACG TACGCAGTGC ACCCAGGCAT CGTCCAGTCT GAGCTGGTCC GGCATTCCTT
CCTGCTGTGC CTGCTCTGGC GGCTCTTCTC CCGCTTCCTC AAAACAGCGC GGGAGGGGCC
CAGACCAGCC TGCACTGCGC CCTGGCCGAG GGCCTGGAGC CCCTGAGCGG CAAGTACTTC
AGTGACTGCA AGAGGGCCTG GGTGTCGCCA AGGGCCCGGA ATAACAAAAC GGCCGAGCGC
TTGTGGAACG TCAGCTGCGA GCTCCTGGGA ATCCAGTGGG AGTAGAGCTG CTGGAAGATG
CGCGGCTGTA TCAAGCCTGG TCCAGGCCAT AACGCAGACC GGGGAGATGG CCCACCCCGA
AGGACTGACC TGGCTGGCTG CTGTCCCAAA CACTTCCCTG CTTTGATTCT CCTGATCCTT
GGAAAACCTC CCCACACCTA ACCCTCTTAC CAGGCTGATT CTCGGCATAA GAGGTTCATA
CCTGGAGAGC ATCGTCCTTG AAAAAAAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 242) [FASTA format sequence]
MQLPGKVVVI TGANTGIGKE TARELARRGA RVYIACRDVL KGESAASEIR ADTKNSQVLV
RKLDLSDTKS IRAFAEGFLT EEKQLHILIN NAGVMLCPYS KTADGFETHL GVNHLGHFLL
THLLLEQLKA SAPARVVNLS SVVHHAGKIR FHDLQGEKHY NRGFAYCHSK LANVLFTREL
AKRLQGTGVT TYAVHPGIVQ SELVRHSFLL CLLWRLFSRF LKTAREGPRP ACTAPWPRAW
SP


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Homo sapiens]. 424e-148
Contig/Assembly ProteinRDH11retinol dehydrogenase 11 [Homo sapiens]. 350e-114
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 isoform 1 [Homo sapiens]. 2256e-66
Contig/Assembly ProteinRDH14retinol dehydrogenase 14 [Homo sapiens]. 2021e-60
Contig/Assembly ProteinRDH16retinol dehydrogenase 16 [Homo sapiens]. 65.11e-10


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRdh12retinol dehydrogenase 12 [Mus musculus]. 390e-136
Contig/Assembly ProteinRdh11retinol dehydrogenase 11 [Mus musculus]. 341e-111
Contig/Assembly ProteinRdh13retinol dehydrogenase 13 [Mus musculus]. 2214e-65
Contig/Assembly ProteinRdh14retinol dehydrogenase 14 [Mus musculus]. 2049e-62
Contig/Assembly ProteinCbr3carbonyl reductase 3 [Mus musculus]. 59.37e-09


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC490744PREDICTED: similar to retinol dehydrogenase 12 (all-trans and 9-cis) [Canis familiaris]. 412e-144
Contig/Assembly ProteinLOC480366PREDICTED: similar to Retinol dehydrogenase 11 (Retinal reductase 1) (RalR1) (Prostate short-chain dehydrogenase/reductase 1) (Androgen-regulated short-chain dehydrogenase/reductase 1) (HCV core-binding protein HCBP12) [Canis familiaris]. 329e-107
Contig/Assembly ProteinLOC611373PREDICTED: similar to Retinol dehydrogenase 13 [Canis familiaris]. 2312e-68
Contig/Assembly ProteinLOC482983PREDICTED: similar to retinol dehydrogenase 14 (all-trans and 9-cis) isoform 1 [Canis familiaris]. 2003e-60


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Bos taurus]. 419e-147
Contig/Assembly ProteinRDH11PREDICTED: retinol dehydrogenase 11-like [Bos taurus]. 331e-108
Contig/Assembly ProteinRDH13retinol dehydrogenase 13 [Bos taurus]. 2261e-66
Contig/Assembly ProteinDHRS12dehydrogenase/reductase SDR family member 12 [Bos taurus]. 1034e-22


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinRDH12retinol dehydrogenase 12 [Sus scrofa]. 461e-162
Contig/Assembly ProteinLOC100154684PREDICTED: retinol dehydrogenase 11 [Sus scrofa]. 345e-113
Contig/Assembly ProteinLOC100516970PREDICTED: retinol dehydrogenase 14-like [Sus scrofa]. 2045e-62
Contig/Assembly ProteinLOC100513982PREDICTED: retinol dehydrogenase 12-like [Sus scrofa]. 1063e-23
Contig/Assembly ProteinLOC100519057PREDICTED: dehydrogenase/reductase SDR family member 9-like, partial [Sus scrofa]. 58.21e-08


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-218964.1TGATCAACAATGCTGGAGTGATGTTGTGTCCATATTCCAAGACAGCGGATGGCTTTGAGA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2010100120101001C-01136074fwd
2011060120110601C-00208574fwd