[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  PBL01_0002_C07

Library: PBL01 (PBMC)
Individual: LWD5, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,300)  [FASTA format sequence]
TTTTGTGTTG GCTGGAGCCG GAGCAACAAG ATGGCGGCGT CGGCGGAGTG ACAGGGGTCC
CTCCGGGCGG GAGCTGGCGG CAGCGGGGGC AGCGGGATCG CCGCCCTAAC TCACCGCGCC
CCTTTTCCAG CCGGCGACGT CGCCGCGAGA GCGAGGCAGC GGCGGCCGCC AGGAACAAGT
GGCCCGGCCC GGCAACCGCG AGCACCGCCT CGGCAGCCTG CGGCCTGGCC GGAGGAAGCC
TGACAGCCGC GGAGATCCGG GTCCGCCTGG CCGGTTCCGG GCCTGTAGCG CCGAGAAGGA
GCCAGCGCCC CCCGGTTCCT GCCGCGCTCC GCGGACGAGC GCTAGAGGCC TCCGTCGTCC
CCTAGAGGTG TCGGGGCTTG GCCCCAGCCT CCATCTTCTC CCAGG
ATGGC GAGCAGCAGC
GGCTCCAAGG CCGAGTTCAT TGTCGGAGGG AAGTACAAAC TGGTGCGGAA GATCGGCTCT
GGCTCCTTCG GGGACATTTA CCTGGCGATC AACATCACCA ACGGCGAGGA AGTGGCAGTG
AAGCTAGAAT CTCAGAAGGC CAGGCATCCC CAGTTGCTGT ACGAGAGCAA ACTCTATAAG
ATTCTTCAAG GTGGGGTCGG CATCCCCCAC ATACGGTGGT ATGGTCAGGA AAAAGACTAC
AATGTGCTCG TGATGGACCT GCTCGGACCC AGCCTCGAAG ACCTCTTCAA CTTCTGTTCC
AGAAGGTTCA CAATGAAAAC TGTACTCATG TTAGCCGACC AGATGATCAG TAGAATTGAA
TATGTGCATA CAAAGAACTT TATACACAGA GACATTAAAC CAGATAACTT CCTAATGGGT
ATTGGGCGTC ACTGTAATAA GTTATTCCTT ATTGATTTTG GTTTGGCCAA AAAGTACAGA
GACAACAGGA CAAGGCAACA CATACCATAC AGAGAAGATA AAAATCTCAC TGGCACTGCC
CGATACGCTA GCATCAATGC ACATCTTGGT ATTGAACAGA GTCGCCGAGA TGACATGGAA
TCATTAGGAT ATGTTTTGAT GTATTTTAAT AGAACCAGTC TGCCATGGCA AGGACTCAAG
GCTGCAACAA AGAAGCAAAA ATATGAAAAA ATTAGCGAAA AGAAGATGTC CACACCTGTG
GAAGTTTTGT GTAAGGGGTT TCCTGCAGAA TTTGCCATGT ACTTAAACTA TTGTCGTGGG
CTGCGCTTTG AGGAAGCCCC GGATTACATG TACCTGAGAC AGCTATTCCG CATTCTTTTC
AGGACCCTGA ATCACCAATA TGACTACACA TTTGACTGGA CAATGTTAAA GCAGAAAGCA
GCACAGCAAG CAGCCTCTTC AAGTGGGCAG GGTCAGCAGG CCCAAACCCC CACAGGCAAG
CAAACTGACA AAACCAAGAG TAACATGAAA GGTTTCTAAG CATGAATCGA GGAACAGAAG
CAGCAGAGCA GATGATCGGA GCAGCATTTG TTTCTCCCCA AATCTAGACA TTTTAGTTCA
TATGTACACT AGCCAGTGGC TGTGGACAAC CATTTCCTTG GTGTAAAGAA CTTCATTTCG
GTATAAACTG GCTCTGGGCA GCACTGGCGA TACTGCGTCC CGAGTTGTAG CCGCTGTAAT
TGTGAATATT AACTGAGATA GTGAGACATG GTGTCCAGTT TTCTATTGCA TTTTTTCAAG
TGGAAAAGTT AACTGAGTGG TTGACACACA CAAATTGGTG GACAGATTGT GCATATGCCA
ATTGTTTTGT TAAAACCTTT TCTTTTGAAC TATACTGCTT TGAGATCTCA CTTCAGAAGA
ACGGCATGAA CAGTCTTCAG CCGCAGTTGT GATGGTTGTA AATGCTCGCA GCTGTGCGTT
CTTAGGGTTT CTTCATCCCT GGGGTTTGCA AGTTGTTCAC TTAAAACATT CTTAACATGG
TTGGCTTCTT GTGTGCAAGC CAGCTGATAT GGTAGCAACC AAAGATTCCA GTGTTTGAGC
ATATGAAAGA CTCTGCCTGC TTACCTGTGC TAGAAATAAC AGCATCTAAA GTGAAGACTT
AAGAAAAACT TAGTGACTAC TAGATTATCC GTAGGACTCT GCATTAACTC TATAATGTTC
TTGGTATTAA AAAAAGCATA TTTGTCACAG AAATTTAGTT AACATCTTAC AACTGAACAT
GTGTGTATGT TGCTTAGATA AATGTAATCA CTGTAAACAT CTATATGATC TGGGATTTTG
TTTTTATTTT GAAATGGGAG CTCTTTTTTG TTTACAAGTT CATTAAAAAC TAAAAACTGT
TAAAAAAAAA AAAAAAAAAA

Deduced amino acid sequence:  (length: 337) [FASTA format sequence]
MASSSGSKAE FIVGGKYKLV RKIGSGSFGD IYLAINITNG EEVAVKLESQ KARHPQLLYE
SKLYKILQGG VGIPHIRWYG QEKDYNVLVM DLLGPSLEDL FNFCSRRFTM KTVLMLADQM
ISRIEYVHTK NFIHRDIKPD NFLMGIGRHC NKLFLIDFGL AKKYRDNRTR QHIPYREDKN
LTGTARYASI NAHLGIEQSR RDDMESLGYV LMYFNRTSLP WQGLKAATKK QKYEKISEKK
MSTPVEVLCK GFPAEFAMYL NYCRGLRFEE APDYMYLRQL FRILFRTLNH QYDYTFDWTM
LKQKAAQQAA SSSGQGQQAQ TPTGKQTDKT KSNMKGF


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCSNK1A1casein kinase I isoform alpha isoform 2 [Homo sapiens]. 587e-167O
Contig/Assembly ProteinCSNK1A1Lcasein kinase I isoform alpha-like [Homo sapiens]. 540e-153
Contig/Assembly ProteinCSNK1Ecasein kinase I isoform epsilon [Homo sapiens]. 447e-125O
Contig/Assembly ProteinCSNK1G3casein kinase I isoform gamma-3 isoform 2 [Homo sapiens]. 3128e-85


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCsnk1a1casein kinase I isoform alpha [Mus musculus]. 577e-164O
Contig/Assembly ProteinCsnk1ecasein kinase I isoform epsilon [Mus musculus]. 447e-125
Contig/Assembly ProteinCsnk1dcasein kinase I isoform delta isoform 1 [Mus musculus]. 445e-125O
Contig/Assembly ProteinTtbk2tau-tubulin kinase 2 isoform 2 [Mus musculus]. 1612e-39


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479331PREDICTED: similar to Casein kinase I, alpha isoform (CKI-alpha) (CK1) isoform 1 [Canis familiaris]. 587e-167O


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCSNK1A1casein kinase I isoform alpha [Bos taurus]. 577e-164O
Contig/Assembly ProteinLOC100300748PREDICTED: casein kinase I alpha-like [Bos taurus]. 553e-157
Contig/Assembly ProteinLOC613515PREDICTED: casein kinase I-like [Bos taurus]. 505e-143
Contig/Assembly ProteinCSNK1G1casein kinase I isoform gamma-1 [Bos taurus]. 3133e-85


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCSNK1A1PREDICTED: casein kinase I isoform alpha isoform 1 [Sus scrofa]. 587e-168
Contig/Assembly ProteinCSNK1EPREDICTED: casein kinase I isoform epsilon isoform 2 [Sus scrofa]. 447e-125
Contig/Assembly ProteinTTBK2PREDICTED: tau-tubulin kinase 2 [Sus scrofa]. 1602e-39


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-100924.1CTTAGTGACTACTAGATTATCCGTAGGACTCTGCATTAACTCTATAATGTTCTTGGTATT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-00329211fwd
2003082620030826C-00071111fwd
2005032220050322C-00545618fwd
2006061120060611C-00097020fwd
2007080620070806C-00110521fwd
2008051520080515C-00251218fwd
2010100120101001C-00220034fwd
2011060120110601C-00260935fwd