[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  PBL01_0098_A03

Library: PBL01 (PBMC)
Individual: LWD5, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,185)  [FASTA format sequence]
CTTTCCCAGC TCCATCCTCA TCATTGCTCT ACAACTCCGA AGAGCAACAG CTGAGACCAC
CTTGAGAAGA GC
ATGGTCCC AGGCCGAGTT CTGATGTGGG GGGCCCTCGC CCTGACCGCC
GTGATGAGCG CCTGTGGAGG TGAAGACATT GCGGCCGACC ATGTTGCCTC CTATGGCTTA
AATGTCTACC AGTCTTACGG TCCCAGCGGC TATTATACCC ATGAATTTGA TGGCGACGAG
GAATTCTACG TGGACCTGGG GAAGAAGGAG ACTGTCTGGC AGCTGCCTCT GTTTAGCAAA
TTTAGAAGTT TTGACCCACA GGGTGCACTG AGGAACATAG CTACGGCAAA ACATAATTCG
AACATCCTGA TTAAACGTTC CAACAACACC GCGGCTGTCA ATCAGGTTCC TGAGGTGACT
GTGTTTCCCA AGTCTCCAGT GATGCTGGGT CAGCCCAACA CCCTCATCTG TCATGTGGAC
AACATCTTTC CTCCTGTGAT CAACATCACG TGGTTGAAGA ACGGGCACTC TGTCACAGAA
GGTTTTTCTG AGACCAGCTT CCTCTCCAAA AATGATCATT CCTTCCTCAA GATCAGTTAT
CTCACCTTCC TCCCTTCTGA TGATGATTTT TATGACTGCA AAGTGGAGCA CTGGGGCCTG
GATAAGCCAC TTCTGAAACA CTGGGAACCT GAGATTCCAG CCCCCATGTC AGAGCTGACA
GAGACAGTGG TCTGCGCCCT GGGATTGATC GTGGGCCTTG TGGGCATCGT GGTGGGCACT
GTCTTCATCA TTCAAGGCCT GCGCTCAGGT GGTCCCTCTA GACACCAAGG GTCCTTGTGA
GTCACACTCC AGAAGGGAAG GTGCACTGCC CGCCTACAAG AGCTGAAGAG TGGATGTGCT
CAACGACCTA GAACTATTTT CTGGCCAAAT TCATCATATA CCTTCTCTCT CCCTACATTC
TTCTTCTCAC CTCTTCTCTG GAACTTAAGG TGCTGTGTCA TCTCAGAATT CATATGCCCT
TGGAATCCTC TTCCTGACCT TCTAGGTTTT TTTTCTTTTC TCAGTTGTTA CCTGTTATGG
GATCTCTGAG ATATCCCACT CGGCTACCTG ATCCCTCAGT GACCCTAAAC TAATATGTAC
ATGGAAACAA TAAATCACTT CATGAGGAAA AAAAAAAAAA AAAAA

Deduced amino acid sequence:  (length: 255) [FASTA format sequence]
MVPGRVLMWG ALALTAVMSA CGGEDIAADH VASYGLNVYQ SYGPSGYYTH EFDGDEEFYV
DLGKKETVWQ LPLFSKFRSF DPQGALRNIA TAKHNSNILI KRSNNTAAVN QVPEVTVFPK
SPVMLGQPNT LICHVDNIFP PVINITWLKN GHSVTEGFSE TSFLSKNDHS FLKISYLTFL
PSDDDFYDCK VEHWGLDKPL LKHWEPEIPA PMSELTETVV CALGLIVGLV GIVVGTVFII
QGLRSGGPSR HQGSL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 2 [Homo sapiens]. 391e-109
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 3 [Homo sapiens]. 383e-106


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2-Aahistocompatibility 2, class II antigen A, alpha precursor [Mus musculus]. 3386e-93
Contig/Assembly ProteinH2-Oahistocompatibility 2, O region alpha locus [Mus musculus]. 2302e-60
Contig/Assembly ProteinH2-Ea-pshistocompatibility 2, class II antigen E alpha precursor [Mus musculus]. 2156e-56
Contig/Assembly ProteinH2-DMaclass II histocompatibility antigen, M alpha chain precursor [Mus musculus]. 797e-15
Contig/Assembly ProteinH2-DMb2histocompatibility 2, class II, locus Mb2 [Mus musculus]. 63.53e-10


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha [Canis lupus familiaris]. 384e-106
Contig/Assembly ProteinLOC474869PREDICTED: similar to HLA class II histocompatibility antigen, DO alpha chain precursor (MHC class II antigen DOA) (MHC DZ alpha) (MHC DN-alpha) isoform 11 [Canis familiaris]. 2311e-60
Contig/Assembly ProteinDLA-DRAMHC class II DR alpha chain [Canis lupus familiaris]. 2257e-59
Contig/Assembly ProteinHLA-DOBmajor histocompatibility complex, class II, DO beta [Canis lupus familiaris]. 60.53e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha 5 [Bos taurus]. 375e-104
Contig/Assembly ProteinBOLA-DQA1major histocompatibility complex, class II, DQ alpha, type 1 [Bos taurus]. 369e-102
Contig/Assembly ProteinLOC100336394PREDICTED: BOLA-DQA2 protein-like [Bos taurus]. 365e-101
Contig/Assembly ProteinBOLA-DQA3major histocompatibility complex, class II, DQ alpha, type 3 [Bos taurus]. 3553e-98
Contig/Assembly ProteinBOLA-DRAmajor histocompatibility complex, class II, DR alpha [Bos taurus]. 2264e-59


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLA-DQA1SLA class II histocompatibility antigen, DQ haplotype D alpha chain precursor [Sus scrofa]. 472e-133
Contig/Assembly ProteinSLA-DQASLA class II histocompatibility antigen, DQ haplotype C alpha chain precursor [Sus scrofa]. 443e-125
Contig/Assembly ProteinSLAsrc-like-adapter [Sus scrofa]. 2592e-69
Contig/Assembly ProteinSLA-DRAMHC class II DR-alpha [Sus scrofa]. 2231e-58
Contig/Assembly ProteinLOC100513292PREDICTED: DLA class II histocompatibility antigen, DR-1 beta chain-like [Sus scrofa]. 63.52e-10


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-151884.1TACCTGATCCCTCAGTGACCCTAAACTAATATGTACATGGAAACAATAAATCACTTCATG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2005032220050322C-000197384fwd
2006061120060611C-000165389fwd
2007080620070806C-000038388fwd
2008051520080515C-000329397fwd
2010100120101001C-001170425fwd
2011060120110601C-001518452fwd