[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  PTG01_0051_B10

Library: PTG01 (Pituitary gland)
Individual: LWD4, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,435)  [FASTA format sequence]
GCTCGGTACT CAGTGCGCAG GTGCGAAGCC TCTTGGCTGG GGCCCTGGCC GGGGGCTGGC
TTGAAGACGC GTCGTTTGGT TTTGGACGCT TTGAGAGAGC CGTCTGGTAT CAACCGCTGG
GCGGAAGGCG TTTGTCAGGG GCCCGGCCAC GAACGAGGCC CACGAGTTTC CCG
ATGGTGT
CCATGACTTT CAAGCGGAGC CGCAGCGACC GGTTCTACAG CACCCGGTGC TGCGGCTGTT
GCCATGTCCG CACCGGGACG ATCATCCTGG GGACCTGGTA CATGGTGGTC AACCTGTTGA
TGGCAATTTT GCTGACTGTT GAGGTGACAC ATCCAAACTC AGTGCCAGCT GTCAACATTC
AGTATGAAGT CATTGGCAAT TACTATTCAT CTGAGAGAAT GGCAGATAAT GCCTGTGTTC
TTTTTGCGGT CTCTGTTCTT ATGTTTATAA TCAGTTCAAT GCTGGTTTAT GGAGCAATTT
CTTATCAAGT GGGTTGGTTG ATTCCATTCT TCTGTTACCG GCTTTTTGAC TTCGTTCTCA
GCTGCCTGGT TGCTATCAGT TCTCTAACTT ACTTGCCAAG AATCAAAGAA TATCTGGATC
AATTACCTGA TTTCCCCTAT AAAGACGACC TCCTGGCATT GGACTCCAGC TGCCTCCTGT
TCATTGTTCT TGTGTTCTTT GCCTTGTTCA TCATTTTTAA GGCTTATCTA ATCAACTGTG
TTTGGAACTG TTACAAATAC ATCAACAACA GAAACATGCC AGAGATTGCT GTGTATCCTG
CCTTTGAAGC ACCTCCACAG TATGTTTTGC CAACCTATGA AATGGCAGTG AAGATGCCTG
AGAAAGAACC CCCGCCTCCT TACATACCTG CCTGAAGAAA TGCTGCCTTT GTCAATAAAC
CCTATACCAG CTTTTCGTCT TGTTTATTTT ACAGAATGCT GCAATACAGG GCTCTTCAAA
CTTGTTTGAT ATAAAGTACA TTTTACTTTA AGCATTTATT TTCAAACACT AACAAGCTTG
TTGGATATCT ATGAAAAGAC TTTTGTTGTT TTGTTCAGTA TATTACATTT TAATAGTTTT
TGAAGACAAT CTAGGTTAAG AGCAAAATGC CATTGTTTGC CTTTGATTGG GGGGTGGGAA
GGGGGCATTC TCCACACATA ATCTTTTTTA ACTTTGCACT TTCTTCATAT CACAGTTTGT
ATTTTGGTTA TTTGCTGCCC TGGATACTTT CAGGAAGAAT GAAGTAAATA CTCGGGGTGG
GCAAGTTTAG TATAAGATCT GAAGTTTTCA GCTGTGAAAA AAACAAAAAA TATACTACAT
TTTATCTTGA CTGTGGGTGA TGATGGTTGC ATGTTTCTAA TTTGTACGTG TTTCCATCTT
TGTGATAAGA TGCTTTAATA AATCTCTTAA ATATTAAAAA AAAAAAAAAA AAAAA

Deduced amino acid sequence:  (length: 233) [FASTA format sequence]
MVSMTFKRSR SDRFYSTRCC GCCHVRTGTI ILGTWYMVVN LLMAILLTVE VTHPNSVPAV
NIQYEVIGNY YSSERMADNA CVLFAVSVLM FIISSMLVYG AISYQVGWLI PFFCYRLFDF
VLSCLVAISS LTYLPRIKEY LDQLPDFPYK DDLLALDSSC LLFIVLVFFA LFIIFKAYLI
NCVWNCYKYI NNRNMPEIAV YPAFEAPPQY VLPTYEMAVK MPEKEPPPPY IPA


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLAPTM4Alysosomal-associated transmembrane protein 4A [Homo sapiens]. 393e-109
Contig/Assembly ProteinLAPTM4Blysosomal-associated transmembrane protein 4B [Homo sapiens]. 1651e-40
Contig/Assembly ProteinLAPTM5lysosomal-associated transmembrane protein 5 [Homo sapiens]. 50.44e-06


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLaptm4alysosomal-associated transmembrane protein 4A [Mus musculus]. 434e-122
Contig/Assembly ProteinLaptm4blysosomal-associated transmembrane protein 4B [Mus musculus]. 1633e-40
Contig/Assembly ProteinLaptm5lysosomal-associated transmembrane protein 5 [Mus musculus]. 51.22e-06


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC475678PREDICTED: similar to lysosomal-associated protein transmembrane 4 alpha [Canis familiaris]. 397e-110
Contig/Assembly ProteinLOC475042PREDICTED: similar to lysosomal-associated transmembrane protein 4 beta [Canis familiaris]. 1611e-39
Contig/Assembly ProteinLOC487324PREDICTED: similar to Lysosomal-associated multitransmembrane protein (Retinoic acid-inducible E3 protein) (HA1520) [Canis familiaris]. 50.83e-06


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLAPTM4Alysosomal-associated transmembrane protein 4A [Bos taurus]. 397e-110
Contig/Assembly ProteinLAPTM4Blysosomal-associated transmembrane protein 4B [Bos taurus]. 1666e-41
Contig/Assembly ProteinLOC524129PREDICTED: Lysosomal protein transmembrane 4 beta-like [Bos taurus]. 1235e-28
Contig/Assembly ProteinLAPTM5lysosomal-associated transmembrane protein 5 [Bos taurus]. 50.83e-06


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100516188PREDICTED: lysosomal-associated transmembrane protein 4A-like [Sus scrofa]. 399e-111
Contig/Assembly ProteinLOC100624193PREDICTED: lysosomal-associated transmembrane protein 5-like [Sus scrofa]. 51.61e-06


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-094204.1GTGATGATGGTTGCATGTTTCTAATTTGTACGTGTTTCCATCTTTGTGATAAGATGCTTT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2008051520080515C-00098878fwd
2010100120101001C-01141276fwd
2011060120110601C-00213777fwd