[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  PTG01_0086_A12

Library: PTG01 (Pituitary gland)
Individual: LWD4, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,137)  [FASTA format sequence]
TTTAGGATTA CCTCAACCTC TCCTGGACCT GAATGACTCT CCTGTCTACA AAACGATCTT
GGAACAA
ATG CAGCGTTTCT TCTGCACCCT CTATGAAAAC TGTTTCCACA TCCTAGGGAA
GGCAGGCCCT TCCATGCAGC AGGACTTCTA CACCGTGGAG CAGCTGTCCA CCCAGCTCCT
CAGCTCTGCC TTTGTCAACT TGGACAATCT TCCTGACTAC CGACTCAGAC CCTTGCTTCG
GGTCTTTGTG AAGCCTCTGG TGCTCGCCTG TACCCCCGAG TACTATGAAA GCCTGGTGTC
GCCCATCGTT GGGCCTCTTT TCACCTACCT CCACATGAGG CTTTCCCAAA AATGGCAAGT
CATCAACCAG AGGAGCATGC TGTGTGAAGA TGAGACGTCA GATGAAAACC CAGAGTCTCA
AGAGATGCTG GAGGAGCAAC TGGTGAGGAT GTTAACCCGA GAAGTCGTGG ACCTGATCAC
CGTGTGCTGT GTCTCAAAGA AGGGTGCTGA CCACACTGCT ACTCCCGCTG CGGATGGAGA
GGATGAAGAG ATGATAGCCA CAGAGGTAGC CACTCCAGCC ACGGCAGAGC TCACAGACCT
GGGAAAGTGT CTGACGAAGC ACGAGGATGT TTGCACAGCG CTGTTAATTC TAGCCTTCAA
CTCCCTCGCC TGGAAGGATA CTCTGTCCTG CCAGAGGACC ACCACGCAGC TCTGCTGGCC
CCTCCTCAAG CAAGTGCTAT CGGGGACTCT GCTGGCAGAA GCTGTCACAT GGCTCTTCAC
CAGCGTGCTG AAGGGCTTAC AGACACACGG GCAGCATGAC GGCTGCATGG CTTCCTTGGT
CCACCTGGCC TTCCAGACGT ATGAGGCGCT GCGTCCCAGG TACGTGGAGA TAAGAGCTGT
GATGGAGCAG ATCCCTGACA TTCAGAAGGA GTCTCTGGAC CAGTTTGACT GCAAGCTTTT
GAACCCCTCT CTGCAGAAAG CGGCTGATAA GCGCCGGAAG GACCAATTCA AACGCCTGAT
TGCTGGGTGC ATCGGGAAAC CCTTGGGCGA GCAGTTCCGA AAAGAAGTTC ACATTAAGAA
TCTTCCTTCA CTTTTCAAAA AAACAAAGCC AACCCATGAC TCGGATGCAC TGGACAACGA
CGAGGGCGGC CTGGCCACCA TCTTTGAACC CTGAATCAAG CTTTCAGGCA TCCTTCTTTG
ACCTTTATTG TCATCTCCTC TTCCCCTTTG TAGCTAATCT CTAGGCCCCT CTCCACTGCA
CCTCACTTTC CACCTTCGTC AGCCTGGAGA GAGGTCCAGG TCTGGAGCTG GAGAGAGTGG
GCCCTGTAGT AGGGCCAGAA GTCATTATAC TAAAGTCTCA AGAAAGGAAG GTAGGGCTTC
TACCGTTCTG TCTAGATTTC CCAGGTCTCT CCCATTCTAC TTGGAGTTTT GGCTTTTCCA
AAAGTGAGAA GCCACAGCAG AGTGGCCCCT ATCCCCAAGC CCTCTCACCC CCAGGCAGCC
GTATACACCT GTGCAGAGTG ACAACCAGGG GGCTCTGTAC CTGATGCTGT ACTGGCTGGG
CTTGCGGCCA GGGCTCAGCC CTGAACTACT TGTGCCAGAG TTTCTCTTGG ACCTTTGAGA
AATCCCACCA AGCCCCCTTG CTGCTGGGCT GGCTGGGAAC CCTCCCCATC CCCCAGGGGT
GTATCTGGGT CAGGTGCTGA GTGAACTGAA TTTGGCCAAT TCCCACTTTG TTTTGAGCAA
GAATCTGATG GGCTCCATGG TACAGGCTAA GCTCTGGGCA CAGTGTCACG ATAGTACCTT
CAGGGACCAG GGCTGGGCAG GGGCCGTAGT GTTCTCTGAT ATCCCTTAGA GCTCACACAT
TTTGTCCTTC CGTGAATGAC CCTTCAGTGT GGTTTCCCCA GCCCCCAGGG TCCACTCAGG
CACAAGAGCC ACAGTACCCT CTCTAGTGTC ACGTGATGCC GTTGGCATTT AAGGATAACC
CAGACCAACT AGGCTACATC TGTGACAGCA GCTAGCAAAG CCACTGGTCT CCTCTCCTAG
CTGAGTCCAG GTGCCTTCAA AGTCTCATGC TCTTTCAGAC CCCCCTGGTC ACCTCCTTCC
TGGGCCATTT CTAAAAAAAA AAAAAAAAAA AAAAAAA

Deduced amino acid sequence:  (length: 368) [FASTA format sequence]
MQRFFCTLYE NCFHILGKAG PSMQQDFYTV EQLSTQLLSS AFVNLDNLPD YRLRPLLRVF
VKPLVLACTP EYYESLVSPI VGPLFTYLHM RLSQKWQVIN QRSMLCEDET SDENPESQEM
LEEQLVRMLT REVVDLITVC CVSKKGADHT ATPAADGEDE EMIATEVATP ATAELTDLGK
CLTKHEDVCT ALLILAFNSL AWKDTLSCQR TTTQLCWPLL KQVLSGTLLA EAVTWLFTSV
LKGLQTHGQH DGCMASLVHL AFQTYEALRP RYVEIRAVME QIPDIQKESL DQFDCKLLNP
SLQKAADKRR KDQFKRLIAG CIGKPLGEQF RKEVHIKNLP SLFKKTKPTH DSDALDNDEG
GLATIFEP


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinXPO5exportin-5 [Homo sapiens]. 7050.0


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinXpo5exportin-5 [Mus musculus]. 6640.0


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC474913PREDICTED: similar to exportin 5 isoform 3 [Canis familiaris]. 7010.0


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinXPO5PREDICTED: exportin 5 [Bos taurus]. 7120.0


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100155084PREDICTED: LOW QUALITY PROTEIN: exportin-5 [Sus scrofa]. 2312e-60


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-161994.1TGATATCCCTTAGAGCTCACACATTTTGTCCTTCCGTGAATGACCCTTCAGTGTGGTTTC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2008051520080515C-00301813fwd
2010100120101001C-00779811fwd
2011060120110601C-00348611fwd