[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  TCH01_0010_G01

Library: TCH01 (Trachea)
Individual: LWD3, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,178)  [FASTA format sequence]
GGATCATTGC TCTACAACTC CGAAGAGCAA CAGCTGAGAC CACCTTGAGA AGAGCATGGT
CCCAGGCCGA GTTCTGATGT GGGGGGCCCT CGCCCTGACC GCCGTGATGA GCGCCTGTGG
AGGTGAAGAC ATTGCGGCCG ACCATGTTGC CTCCTATGGC TTAAATGTCT ACCAGTCTTA
CGGTCCCAGC GGCTATTATA CCCATGAATT TGATGGCGAC GAGGAATTCT ACGTGGACCT
GGGGAAGAAG GAGACTGTCT GGCAGCTGCC TCTGTTTAGC AAATTTAGAA GTTTTGACCC
ACAGGGTGCA CTGAGGAACA TAGCTACGGC AAAACATAAT TTGAACATCC TGATTAAACG
TTCCAACAAC ACCGCGGCTG TCAATCAGGT TCCTGAGGTG ACTGTGTTTC CCAAGTCTCC
AGTGATGCTG GGTCAGCCCA ACACCCTCAT CTGTCATGTG GACAACATCT TTCCTCCTGT
GATCAACATC ACGTGGTTGA AGAACGGGCA CTCTGTCACA GAAGGTTTTT CTGAGACCAG
CTTCCTCTCC AAAAATGATC ATTCCTTCCT CAAGATCAGT TATCTCACCT TCCTCCCTTC
TGATGATGAT TTTTATGACT GCAAAGTGGA GCACTGGGGC CTGGATAAGC CACTTCTGAA
ACACTGGGAA CCTGAGATTC CAGCCCCCAT GTCAGAGCTG ACAGAGACAG TGGTCTGCGC
CCTGGGATTG ATCGTGGGCC TTGTGGGCAT CGTGGTGGGC ACTGTCTTCA TCATTCAAGG
CCTACGCTCA GGTGGTCCCT CTAGACACCA AGGGTCCTTG TGAGTCACAC TCCAGAAGGG
AAGGTGCACT GCCCGCCTAC AAGAGCTGAA GAGTGGATGT GCTCAACGAC CTAGAACTAT
TTTCTGGCCA AATTCATCAT ATACCTTCTC TCTTCCTACA TTCTTCTTCT CACCTCTTCT
CTGGAACTTA AGGTGCTGTG TCATCTCAGA ATTCATATGC CCTTGGAATC CTCTTCCTGA
CCTTCTAGGT TTTTTTTCTT TTCTCAGTTG TTACCTGTTA TGGGATCTCT GAGATATCCC
ACTCGGCTAC CTGATCCCTC AGTGACCCTA AACTAATATG TACATGGAAA CAATAAATCA
CTTCATGAGG TTTTTGTACT GAAAAAAAAA AAAAAAAA

Deduced amino acid sequence:  (length: 255) [FASTA format sequence]
MVPGRVLMWG ALALTAVMSA CGGEDIAADH VASYGLNVYQ SYGPSGYYTH EFDGDEEFYV
DLGKKETVWQ LPLFSKFRSF DPQGALRNIA TAKHNLNILI KRSNNTAAVN QVPEVTVFPK
SPVMLGQPNT LICHVDNIFP PVINITWLKN GHSVTEGFSE TSFLSKNDHS FLKISYLTFL
PSDDDFYDCK VEHWGLDKPL LKHWEPEIPA PMSELTETVV CALGLIVGLV GIVVGTVFII
QGLRSGGPSR HQGSL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 2 [Homo sapiens]. 394e-109
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 3 [Homo sapiens]. 385e-107


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2-Aahistocompatibility 2, class II antigen A, alpha precursor [Mus musculus]. 3401e-93
Contig/Assembly ProteinH2-Oahistocompatibility 2, O region alpha locus [Mus musculus]. 2324e-61
Contig/Assembly ProteinH2-Ea-pshistocompatibility 2, class II antigen E alpha precursor [Mus musculus]. 2171e-56
Contig/Assembly ProteinH2-DMaclass II histocompatibility antigen, M alpha chain precursor [Mus musculus]. 797e-15
Contig/Assembly ProteinH2-DMb2histocompatibility 2, class II, locus Mb2 [Mus musculus]. 63.53e-10


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha [Canis lupus familiaris]. 386e-107
Contig/Assembly ProteinLOC474869PREDICTED: similar to HLA class II histocompatibility antigen, DO alpha chain precursor (MHC class II antigen DOA) (MHC DZ alpha) (MHC DN-alpha) isoform 11 [Canis familiaris]. 2332e-61
Contig/Assembly ProteinDLA-DRAMHC class II DR alpha chain [Canis lupus familiaris]. 2271e-59
Contig/Assembly ProteinHLA-DOBmajor histocompatibility complex, class II, DO beta [Canis lupus familiaris]. 60.53e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha 5 [Bos taurus]. 376e-104
Contig/Assembly ProteinBOLA-DQA1major histocompatibility complex, class II, DQ alpha, type 1 [Bos taurus]. 371e-103
Contig/Assembly ProteinLOC100336394PREDICTED: BOLA-DQA2 protein-like [Bos taurus]. 367e-102
Contig/Assembly ProteinBOLA-DQA3major histocompatibility complex, class II, DQ alpha, type 3 [Bos taurus]. 3587e-99
Contig/Assembly ProteinBOLA-DRAmajor histocompatibility complex, class II, DR alpha [Bos taurus]. 2288e-60


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLA-DQA1SLA class II histocompatibility antigen, DQ haplotype D alpha chain precursor [Sus scrofa]. 474e-134
Contig/Assembly ProteinSLA-DQASLA class II histocompatibility antigen, DQ haplotype C alpha chain precursor [Sus scrofa]. 446e-125
Contig/Assembly ProteinSLAsrc-like-adapter [Sus scrofa]. 2623e-70
Contig/Assembly ProteinSLA-DRAMHC class II DR-alpha [Sus scrofa]. 2262e-59
Contig/Assembly ProteinLOC100513292PREDICTED: DLA class II histocompatibility antigen, DR-1 beta chain-like [Sus scrofa]. 63.52e-10


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-074694.1CCTCAGTGACCCTAAACTAATATGTACATGGAAACAATAAATCACTTCATGAGGTTTTTG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003082620030826C-003433188fwd
2004020420040204C-000223213fwd
2005032220050322C-000197384fwd
2006061120060611C-000165389fwd
2007080620070806C-000038388fwd
2008051520080515C-000329397fwd
2010100120101001C-001170425fwd
2011060120110601C-001518452fwd