[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  TCH01_0075_F01

Library: TCH01 (Trachea)
Individual: LWD3, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 2,310)  [FASTA format sequence]
TGAGCTCCCT CGAGGAGGTG GTGAGGCTGG TGAAGCCCAC AGCCATCATA GGTGTTGCCG
CCATCGCAGG AGCCTTCACG GAGCAGATTC TGAGGGAC
AT GGCCTCCTTC CACGAGCGCC
CTATCATCTT TGCCCTGAGC AACCCCACCA GCAAGGCCGA GTGCACGGCT GAGAAGTGCT
ACCGGGTCAC CGAGGGCCGA GGGATCTTTG CCAGTGGGAG TCCTTTTAAA AGCGTGACCC
TGGAAGATGG CAGGACCTTC ATTCCCGGGC AGGGAAACAA CGCCTACGTG TTCCCCGGAG
TGGCTCTGGG CGTCATCGCT GGCGGGATCC GGCACATCCC AGACGAGATC TTCCTCCTGA
CAGCAGAGCA AATTGCCCAA GAGGTCTCGG AGCAGCATCT GTCACAGGGG AGACTGTACC
CACCGCTCAG CACCATTCGA GACGTGTCTC TGAGAATCGC CATCAAAGTC CTCGACTACG
CGTACAAACA CAACCTGGCC TCCTACTACC CAGAGCCCAA GGACAAGGAG GCTTTTGTAA
GATCCCTGGT CTATACTCCA GACTATGACT CCTTTACGCT GGACAGCTAC ACTTGGCCCA
AGGAAGCCAT GAATGTTCAG AATGTCTGAT GCAATTGCAG AGGTTCATGG GGGGCTGGAT
GAAGCCCAAA GTAACACTGG AACTATAAAT GGGATCCAAA CTGGCCATCC TTGTCATTGT
GTTTTTCCTT TGAACTTTCT GGTATGAAGG GAGATGCCTA GGCATACAGT GGATGACGGC
CTGTCCCTGA AGGCCTTGAA TTCCTTCCCA GGGATTTCTT CATCTGTTTA TTACCAACTA
GACCTGTGGG ACATCTAGAA TCCTGCCTAG AGCTCTGCCT TCACAGAGTC CAGGGTCTAG
AAGAGGAGAT GAGATATGGA CACAGTTCAC TTTGCCACAG GGCAGAAAGT GGTAAGTCTG
TGAAAGAACC GCAGATAAAG GTCACGAGTG CTCAGAGAAG GGAGAGGTAT ATCATATGAC
ATAAGAGAGG GCTCCGGGGT GGCGGGGCAG GGCAGTGTTT GTACTGAGTC CCAAGAGTGA
AGGATGGGTA GGGTTAATGG TAAAATGAGG AATGTAAGGG CAGCCACTGG CCAGAAAGCT
TGGCCCACCC ATCAGGGAGC TCAGTCCCTG TTAGAGGAAG ACAGTTCCTG CAAGACCAGA
CGGGCGTGAG GGCTGAGTGG CTGGAGGCGG CTCACTAGTC AAAAATGGTC ACCGTCCTGT
GGGTTAAGTA CTAGGCATTC CTTTTTGGTT ATTATGAAAA GGAAAACTAG GACTTTCCAC
TGTGGCTCAG TGGTCTACAA ATCCAACTAG CTTTCGTGAG GAGGAGATTT CAATCCCTGG
CTCCACTTGG GGGGTTAGGG ATCCTGCGTT GCTGTGGCTG TGGCATAGGG GGGCATCTAT
AGCTCTAATT CCATCCCTAG CCTGGGATAC TTCCACATGC CATAGGTGCG GCCCTAAAAA
GAAAAAAAGA AAAAAGGAAA ACCAGAGAAA TGTTGGTGGG GAGGCTCAGC AAACCAAGGA
GTAGGAAGGA AGAGAGGCCT TGAAGGGAAG AGCACCCTGG AGAATTCTAG GAAAGACGTG
ATTTCATTTC CTGGCTTCGG AACACTCTCT TCCACGCTTC ACTCTCTGAA CTAATTCAGC
AAACTGGAGC AGTCTTCTTA CAGAATGGCA TCAGTCTGTC CTGAGTGATT CTTAGGCCAA
GTTCAGTCAT AGCTTCACCT CTCTCATGTC CGGCAGAGCC CCCACACCAT GGGGTGGGGT
GGGGGAGACG AGCCTGCGAC TCCCACGATC AAGATCGCTA AATCGCTCAC ATCTATCAGG
ATGGCAGCAG CCGACCTCTC CTCTCACCCT GTAACACAGC AAACAATGGT CCATGGTGGA
CCACTGCCCA CCCCTGCTAC TCCTCAGCCT CCGGATCCCA CCGCCCACAA TAAATGGGTC
CTCTATGGCC ACCTCTCAGT GACAGGCCGG GTGGACTGCT GGGCTCCTAG AAGAGAGTTA
GCAGAGACAT CAGTCAGCTC TCACCCGGGT CTTGTTCTTC CAACATCTGC TTCCTTAGTG
CTGGTGCTCA GCCAAGAAAG AACATCCTGA GAAAACATCC CTCTTCTATA ATCTGTGGAC
TCATAGCTAA TGAGAACATC TTCAGAAGAG GGTTTGATGA GTGAAGCAGG AATCTGAGCA
CCAGGGAGCC GTTTCCATTA CCTTTTCTAC ATTTTGTCCC ACAACTTCCT CGGCACCCCA
ACTCTGTTAT AGGAAAAAAA AAAAAAAAAA

Deduced amino acid sequence:  (length: 176) [FASTA format sequence]
MASFHERPII FALSNPTSKA ECTAEKCYRV TEGRGIFASG SPFKSVTLED GRTFIPGQGN
NAYVFPGVAL GVIAGGIRHI PDEIFLLTAE QIAQEVSEQH LSQGRLYPPL STIRDVSLRI
AIKVLDYAYK HNLASYYPEP KDKEAFVRSL VYTPDYDSFT LDSYTWPKEA MNVQNV


SNP mapping information
SNP IDRel.Chr.Location (cM)
SNP0010490.91b935.8
SNP0010490.9b935.9


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME3NADP-dependent malic enzyme, mitochondrial precursor [Homo sapiens]. 387e-107
Contig/Assembly ProteinME1NADP-dependent malic enzyme [Homo sapiens]. 2666e-71
Contig/Assembly ProteinME2NAD-dependent malic enzyme, mitochondrial isoform 1 precursor [Homo sapiens]. 2182e-56


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinMe3NADP-dependent malic enzyme, mitochondrial precursor [Mus musculus]. 378e-105
Contig/Assembly ProteinMe1NADP-dependent malic enzyme isoform 2 [Mus musculus]. 2696e-72
Contig/Assembly ProteinMe2NAD-dependent malic enzyme, mitochondrial precursor [Mus musculus]. 2091e-53
Contig/Assembly ProteinLOC100505264PREDICTED: NAD-dependent malic enzyme, mitochondrial-like [Mus musculus]. 2091e-53


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC485151PREDICTED: similar to malic enzyme 3, NADP(+)-dependent, mitochondrial isoform 1 [Canis familiaris]. 387e-107


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME3NADP-dependent malic enzyme, mitochondrial [Bos taurus]. 374e-103
Contig/Assembly ProteinME1NADP-dependent malic enzyme [Bos taurus]. 2699e-72
Contig/Assembly ProteinME2NAD-dependent malic enzyme, mitochondrial [Bos taurus]. 2181e-56


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinME3PREDICTED: LOW QUALITY PROTEIN: NADP-dependent malic enzyme, mitochondrial [Sus scrofa]. 392e-109
Contig/Assembly ProteinME1PREDICTED: NADP-dependent malic enzyme [Sus scrofa]. 2703e-72
Contig/Assembly ProteinME2PREDICTED: NAD-dependent malic enzyme, mitochondrial [Sus scrofa]. 1143e-25


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-133554.1GATGAGTGAAGCAGGAATCTGAGCACCAGGGAGCCGTTTCCATTACCTTTTCTACATTTT


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2004020420040204C-0045127fwd
2005032220050322C-00107713fwd
2006061120060611C-00650213fwd
2007080620070806C-00805013fwd
2008051520080515C-00322411fwd
2010100120101001C-0028483fwd
2011060120110601C-0134256fwd