[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  THY01_0022_H06

Library: THY01 (Thymus)
Individual: LWD1, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,252)  [FASTA format sequence]
GCGCTCGATT GCTCGGGTCT GGCGGCGGCA GCATGGCGGC GGGGGCGGCC GAGGCGGCGG
CGGCTGTGGT GGAGGTCGGC TCCGCCGGGC AGTTTGAGGA GCTGCTGCGC CTAAGAGCCA
AGTCCCTGCT GGTGGTCCAT TTCTGGGCAC CATGGGCCCC ACAGTGTGCT CAGATGAACG
ATGTGATGGC CGAGTTAGCC AAGGAGCACC CGCAAGTTTC CTTTGTGAAG TTGGAGGCTG
AAGCTGTTCC TGAAGTGTCT GAAAAATACG GAATTAGTTC TGTACCCACC TTTCTGTTTT
TCAAGAATTC TCAGAGCATT GACCGGTTAG ATGGTGCACA TGCCCCAGAG TTGACCAAAA
AGGTTCAGCG ACATGCGTCC AGCAGCTCTT TCCCATCTGG CGGTAGCGAG CACCTGAAAG
AAGACCTCAG CCTTCGCCTG AAGAAGCTGA CCCACGCTGC CCCCTGCATG CTGTTCATGA
AGGGAACACC CCAGGAGCCG CGCTGCGGTT TCAGCAAGCA GATGGTGGAA ATTCTTAACA
AACATAATAT CCAGTTTAGC AGTTTTGATA TCTTCTCAGA TGAAGAAGTT CGCCAAGGCC
TCAAAACCTA TTCCAATTGG CCCACCTACC CCCAGCCCTA TGTTTCTGGA GAGCTCATAG
GAGGACTTGA TATAATCAAG GAGCTAGAAG CATCTAAAGA ACTAGATACA ATTTGCCCCA
AAGCTCCCAA ATTAGAGGAA AGGCTCAAAG TACTGACAAA TAAAGCTTCT GTGATGCTCT
TTATGAAGGG AAACAAACAG GAAGCCAAGT GTGGTTTCAG CAGACAAATC CTGGAAATTC
TAAATAGTAC TGGTGTCGAC TACGAGACGT TCGACATACT GGAGGATGAG GAAGTCCGGC
AGGGGTTGAA AACCTACTCC AACTGGCCGA CGTACCCTCA GCTGTATGTG AAAGGGGAGC
TGGTCGGAGG CCTGGATATT GTTAAGGGAC TAAAAGAAAA CGGTGAGCTG CTGCCTATCC
TGAAAGGAGA AAACTAATCA GTGGGGGACT TGGTGCCCAG CTACTGCAGG AGGCCGTCAC
TCCGCTGAGT GACCAGTCCC TGAGGTGGCC GAGGAGTAGG AGATGCTTAT CCCCGGTTAC
GCTGGTGTAT TTCTCGAGGC TGCGCTAAGT GAGCGGATGC GACGTGTTTT CCACCCAAAT
GAGAACACAA TAAACATCTT CAAGTTCAAT TGAAAAAAAA AAAAAAAAAA AA

Deduced amino acid sequence:  (length: 334) [FASTA format sequence]
MAAGAAEAAA AVVEVGSAGQ FEELLRLRAK SLLVVHFWAP WAPQCAQMND VMAELAKEHP
QVSFVKLEAE AVPEVSEKYG ISSVPTFLFF KNSQSIDRLD GAHAPELTKK VQRHASSSSF
PSGGSEHLKE DLSLRLKKLT HAAPCMLFMK GTPQEPRCGF SKQMVEILNK HNIQFSSFDI
FSDEEVRQGL KTYSNWPTYP QPYVSGELIG GLDIIKELEA SKELDTICPK APKLEERLKV
LTNKASVMLF MKGNKQEAKC GFSRQILEIL NSTGVDYETF DILEDEEVRQ GLKTYSNWPT
YPQLYVKGEL VGGLDIVKGL KENGELLPIL KGEN


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin-3 [Homo sapiens]. 590e-169O
Contig/Assembly ProteinGLRX5glutaredoxin-related protein 5, mitochondrial precursor [Homo sapiens]. 1027e-22
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Homo sapiens]. 56.26e-08
Contig/Assembly ProteinTXNthioredoxin [Homo sapiens]. 53.54e-07


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGlrx3glutaredoxin-3 [Mus musculus]. 593e-169O
Contig/Assembly ProteinGlrx5glutaredoxin-related protein 5, mitochondrial [Mus musculus]. 1026e-22
Contig/Assembly ProteinTxnl1thioredoxin-like protein 1 [Mus musculus]. 56.25e-08
Contig/Assembly ProteinTxndc2thioredoxin domain-containing protein 2 isoform 1 [Mus musculus]. 55.87e-08


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477869PREDICTED: similar to Thioredoxin-like 2 protein (PKC-interacting cousin of thioredoxin) (PKCq-interacting protein) (PKC-theta-interacting protein) [Canis familiaris]. 595e-170O
Contig/Assembly ProteinLOC474798PREDICTED: similar to Thioredoxin (ATL-derived factor) (ADF) (Surface associated sulphydryl protein) (SASP) [Canis familiaris]. 521e-06


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin-3 [Bos taurus]. 602e-172O
Contig/Assembly ProteinGLRX5glutaredoxin-related protein 5, mitochondrial [Bos taurus]. 1002e-21
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Bos taurus]. 55.51e-07
Contig/Assembly ProteinTXNthioredoxin [Bos taurus]. 53.93e-07O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin 3 [Sus scrofa]. 627e-180
Contig/Assembly ProteinLOC100154744PREDICTED: glutaredoxin-related protein 5, mitochondrial-like [Sus scrofa]. 1001e-21
Contig/Assembly ProteinTXNthioredoxin [Sus scrofa]. 54.31e-07


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-192594.1AGTGAGCGGATGCGACGTGTTTTCCACCCAAATGAGAACACAATAAACATCTTCAAGTTC


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0005959fwd
2003082620030826C-00058213fwd
2004020420040204C-00058321fwd
2005032220050322C-00527926fwd
2006061120060611C-00595732fwd
2007080620070806C-00082832fwd
2008051520080515C-00155036fwd
2010100120101001C-00209741fwd
2011060120110601C-01269847fwd