[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  THY01_0054_H04

Library: THY01 (Thymus)
Individual: LWD1, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,185)  [FASTA format sequence]
TCATTGCTCT ACAACTCCGA AGAGCAACAG CTGAGACCAC CTTGAGAAGA GCATGGTCCC
AGGCCGAGTT CTGATGAGGG GGGCCCTCGC CCTGACCGCC GTGATGAGCG CCTGTGGAGG
TGAAGACATT GCGGCCGACC ATGTTGCCTC CTATGGCTTA AATGTCTACC AGTCTTACGG
TCCCAGCGGC TATTATACCC ATGAATTTGA TGGCGACGAG GAATTCTATG TGGACCCGGA
GAAGAAGGAG ACTGTCTGGC AGCTGCCTCT GTTTAGCAAA TTTACAAGTT TTGACCCGCA
GGGTGCACTG AGGAACATAG CTACGGCAAA ACATAATTTG AACATCCTGA TTAAACGTTC
CAACAACACC GCGGCTGTCA ATCAGGTTCC TGAGGTGACT GTGTTTCCCA AGTCTCCAGT
GATGCTGGGT CAGCCCAACA CCCTCATCTG TCATGTGGAC AACATCTTTC CTCCTGTGAT
CAACATCACG TGGTTGAAGA ACGGGCACTC TGTCACAGAA GGTTTTTCTG AGACCAGCTT
CCTCTCCAAA AATGATCATT CCTTCCTCAA GATCAGTTAT CTCACCTTCC TCCCTTCTGA
TGATGATTTT TATGACTGCA AAGTGGAGCA CTGGGGCCTG GATAAGCCAC TTCTGAAACA
CTGGGAACCT GAGATTCCAG CCCCCATGTC AGAGCTGACA GAGACAGTGG TCTGCGCCCT
GGGATTGATC GTGGGCCTTG TGGGCATCGT GGTGGGCACT GTCTTCATCA TTCAAGGCCT
GCGCTCAGGT GGTCCCTCTA GACACCAAGG GTCCTTGTGA GTCACACTCC AGAAGGGAAG
GTGCACTGCC CGCCTACAAG AGCTGAAGAG TGGATGTGCT CAACGACCTA GAACTATTTT
CTGGCCAAAT TCATCATATA CCTTCTCTCT TCCACATTCT TCTTCTCACC TCTTCTCTGG
AACTTAAGGT GCTGTGTCAT CTCAGAATTC ATATGCCCTT GGAATCCTCT TCCTGACCTT
CTAGGTTTTT TTTCTTTTCT CAGTTGTTAC CTGTTATGGG ATCTCTGAGA TATCCCACTC
GGCTACCTGA TCCCTCAGTG ACCCTAAACT AATATGTACA TGGAAACAAT AAATCACTTC
ATGAGGTTTT TGTACTGAAA AAAAAAAAAA AAAAAAAAAA AAAAA

Deduced amino acid sequence:  (length: 255) [FASTA format sequence]
MVPGRVLMRG ALALTAVMSA CGGEDIAADH VASYGLNVYQ SYGPSGYYTH EFDGDEEFYV
DPEKKETVWQ LPLFSKFTSF DPQGALRNIA TAKHNLNILI KRSNNTAAVN QVPEVTVFPK
SPVMLGQPNT LICHVDNIFP PVINITWLKN GHSVTEGFSE TSFLSKNDHS FLKISYLTFL
PSDDDFYDCK VEHWGLDKPL LKHWEPEIPA PMSELTETVV CALGLIVGLV GIVVGTVFII
QGLRSGGPSR HQGSL


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100507718PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 2 [Homo sapiens]. 391e-109
Contig/Assembly ProteinHLA-DQA2HLA class II histocompatibility antigen, DQ alpha 2 chain precursor [Homo sapiens]. 384e-107
Contig/Assembly ProteinLOC100509457PREDICTED: HLA class II histocompatibility antigen, DQ alpha 1 chain-like isoform 3 [Homo sapiens]. 383e-106


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinH2-Aahistocompatibility 2, class II antigen A, alpha precursor [Mus musculus]. 3393e-93
Contig/Assembly ProteinH2-Oahistocompatibility 2, O region alpha locus [Mus musculus]. 2318e-61
Contig/Assembly ProteinH2-Ea-pshistocompatibility 2, class II antigen E alpha precursor [Mus musculus]. 2186e-57
Contig/Assembly ProteinH2-DMaclass II histocompatibility antigen, M alpha chain precursor [Mus musculus]. 77.82e-14
Contig/Assembly ProteinH2-DMb2histocompatibility 2, class II, locus Mb2 [Mus musculus]. 63.53e-10


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha [Canis lupus familiaris]. 384e-106
Contig/Assembly ProteinLOC474869PREDICTED: similar to HLA class II histocompatibility antigen, DO alpha chain precursor (MHC class II antigen DOA) (MHC DZ alpha) (MHC DN-alpha) isoform 11 [Canis familiaris]. 2325e-61
Contig/Assembly ProteinDLA-DRAMHC class II DR alpha chain [Canis lupus familiaris]. 2295e-60
Contig/Assembly ProteinHLA-DOBmajor histocompatibility complex, class II, DO beta [Canis lupus familiaris]. 60.53e-09


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinHLA-DQA1major histocompatibility complex, class II, DQ alpha 5 [Bos taurus]. 377e-104
Contig/Assembly ProteinLOC100336394PREDICTED: BOLA-DQA2 protein-like [Bos taurus]. 368e-102
Contig/Assembly ProteinBOLA-DQA1major histocompatibility complex, class II, DQ alpha, type 1 [Bos taurus]. 367e-102
Contig/Assembly ProteinBOLA-DQA3major histocompatibility complex, class II, DQ alpha, type 3 [Bos taurus]. 3553e-98
Contig/Assembly ProteinBOLA-DRAmajor histocompatibility complex, class II, DR alpha [Bos taurus]. 2242e-58


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinSLA-DQA1SLA class II histocompatibility antigen, DQ haplotype D alpha chain precursor [Sus scrofa]. 471e-133
Contig/Assembly ProteinSLA-DQASLA class II histocompatibility antigen, DQ haplotype C alpha chain precursor [Sus scrofa]. 442e-124
Contig/Assembly ProteinSLAsrc-like-adapter [Sus scrofa]. 2617e-70
Contig/Assembly ProteinSLA-DRAMHC class II DR-alpha [Sus scrofa]. 2279e-60
Contig/Assembly ProteinLOC100513292PREDICTED: DLA class II histocompatibility antigen, DR-1 beta chain-like [Sus scrofa]. 63.52e-10


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-074694.1CCTCAGTGACCCTAAACTAATATGTACATGGAAACAATAAATCACTTCATGAGGTTTTTG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-000058158fwd
2003082620030826C-00343211fwd
2004020420040204C-000223213fwd
2005032220050322C-000197384fwd
2006061120060611C-000165389fwd
2007080620070806C-000038388fwd
2008051520080515C-000329397fwd
2010100120101001C-001170425fwd
2011060120110601C-001518452fwd