[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  THY01_0114_B04

Library: THY01 (Thymus)
Individual: LWD1, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,351)  [FASTA format sequence]
GTTATTGTCC AGAAGCTGCA GGGCTCGTTT CTGGCATGAT GGCGCAAAGG GCCTTCCCGA
ATCCTTATGC AGATTTTAAC AAATCCCTGG CCGAAGGCTA CTTTGATTCT GCTGGGAGGC
TCACTCCTGA GTTCTCACAA CGCGTGAACA ATAAGATTCG AGAGCTTCTT CAGCAAATGG
AGAGAGGCCT AAAATCAGCA GACCCTCGCG ATGGCACTGC TTACACTGGA TGGGCAGGTA
TCGCTGTGCT TTACTTACAC CTCTATGATG TGTTTGGGGA CCCTGCCTAC CTGCAGATGG
CACATGGCTA TGCAAAGCAA AGTCTGAACT GTTTGACCAA GCGTTCCATC ACCTTCCTGT
GTGGTGATGC GGGCCCCCTG GCAGTGGCTG CTGTGGTGCA TGACAAGATG AACAATGAGA
AGCAGGCAGA AGACTGTATC ACCCGGCTAA TTCACCTAAA TAAGATTGAC CCGCATGCTC
CAAATGAAAT GCTGTATGGA CGAATGGGCT ACATCTATGC TCTTCTCTTT GTGAATAAGA
ACTTTGGAGT AGAAAAGATT CCTCGAAGCC ATATTCAGCA GATTTGTGAA ACAGTCTTAA
CCTCTGGAGA AAACCTAGCT GGCTAGAAAA AGAAACTTCA CAGAAAAAAC TCCACTGATG
TATGAATGGT ACCAAGAATA TTATGTGGGG GCTGCTCATG GCCTGGCAGG AATTTATTAC
TACCTGATGC AGCCCAGCCT TCAAGTGAGC CATGCGAAGT TACAGAGTTT GGTCAAGCCT
AGTGTAGATT ATGTCTGCCA GCTGAAATTC CCTTCAGGCA ATTACCCTCC TTGTGTGGAC
GACACTCGAG ATCTGCTAGT CCATTGGTGC CACGGTTCCC CTGGGGTAAT CTACATGCTC
ATTCAGGCCT ATAAGGTGTT CAGAGAAGAA CGGTATCTCA ATGATGCCTA CCAGTGTGCC
GATGTGATCT GGAAGTACGG GTTGCTGAAG AAGGGGTACG GGCTGTGCCA CGGCACTGCG
GGGAACGCCT ATGCCTTCCT GACCCTGTTC AACCTCACGC AGGACATGAA GTACCTATAT
AGGGCTTGTA AGTTTGCTGA GTGGTGTCTA GATTATGGAG AACATGGATG CAGAACACCG
GACACTCCTT TCTCCCTCTT TGAAGGAATG GCTGGAACAA TATATTTCCT GGCTGACCTG
CTAGTGCCCA CAAAAGCCAA GTTCCCTGCA TTTGAACTAT AAAAGGAGAG TCTGCCCCCT
GCAACTCACT GCATGAGCAT TTCTGTATAT CAAACCATGA TTAAAGCAAC AGTAGAATCA
AAAAAAAAAA TTAAAAAAAA AAAAAAAAAA A

Deduced amino acid sequence:  (length: 196) [FASTA format sequence]
MMAQRAFPNP YADFNKSLAE GYFDSAGRLT PEFSQRVNNK IRELLQQMER GLKSADPRDG
TAYTGWAGIA VLYLHLYDVF GDPAYLQMAH GYAKQSLNCL TKRSITFLCG DAGPLAVAAV
VHDKMNNEKQ AEDCITRLIH LNKIDPHAPN EMLYGRMGYI YALLFVNKNF GVEKIPRSHI
QQICETVLTS GENLAG


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL1lanC-like protein 1 [Homo sapiens]. 4180.0
Contig/Assembly ProteinLANCL2lanC-like protein 2 [Homo sapiens]. 3119e-85
Contig/Assembly ProteinLANCL3lanC-like protein 3 isoform 2 [Homo sapiens]. 1668e-50


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLancl1lanC-like protein 1 [Mus musculus]. 4050.0
Contig/Assembly ProteinLancl2lanC-like protein 2 [Mus musculus]. 3093e-84
Contig/Assembly ProteinLancl3lanC-like protein 3 [Mus musculus]. 1664e-50


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC478897PREDICTED: similar to LanC-like protein 1 (40 kDa erythrocyte membrane protein) (p40) [Canis familiaris]. 4200.0
Contig/Assembly ProteinLOC483240PREDICTED: similar to LanC-like protein 2 (Testis-specific adriamycin sensitivity protein) [Canis familiaris]. 3102e-84
Contig/Assembly ProteinLOC491823PREDICTED: similar to LanC lantibiotic synthetase component C-like 3 [Canis familiaris]. 1668e-50


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLANCL1lanC-like protein 1 [Bos taurus]. 4210.0
Contig/Assembly ProteinLANCL2lanC-like protein 2 [Bos taurus]. 3055e-83
Contig/Assembly ProteinLANCL3lanC-like protein 3 [Bos taurus]. 1664e-49


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC100153701PREDICTED: lanC-like protein 1 [Sus scrofa]. 4460.0
Contig/Assembly ProteinLOC100620078PREDICTED: lanC-like protein 2-like, partial [Sus scrofa]. 3022e-82
Contig/Assembly ProteinLOC100626898PREDICTED: lanC-like protein 3-like [Sus scrofa]. 1681e-42
Contig/Assembly ProteinLOC100625232PREDICTED: lanC-like protein 1-like [Sus scrofa]. 1294e-30


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-008394.1CCCCTGCAACTCACTGCATGAGCATTTCTGTATATCAAACCATGATTAAAGCAACAGTAG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0006219fwd
2003082620030826C-00076810fwd
2005032220050322C-00085117fwd
2006061120060611C-00082323fwd
2007080620070806C-00097523fwd
2008051520080515C-00189123fwd
2010100120101001C-00714125fwd
2011060120110601C-00151726fwd