[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  UTR01_0001_D08

Library: UTR01 (Uterus)
Individual: LWD1, Crossbred pig ((Landrace x Large White) x Duroc, Western)

Nucleotide sequence:   (length: 1,079)  [FASTA format sequence]
CTGGCGGCGG CAGCATGGCG GCGGGGGCGG CCGAGGCGGC GGCGGCTGTG GTGGAGGTCG
GCTCCGCCGG GCAGTTTGAG GAGCTGCTGC GCCTCAGAGC CAAGTCCCTG CTGGTGGTCC
ATTTCTGGGC ACCATGGGCC CCACAGTGTG CTCAGATGAA CGATGTGATG GCCGAGTTAG
CCAAGGAGCA CCCGCAAGTT TCCTTTGTGA AGTTGGAGGC TGAAGCTGTT CCTGAAGTGT
CTGAAAAATA CGGAATTAGT TCTGTACCCA CCTTTCTGTT TTTCAAGAAT TCTCAGAGCA
TTGACCGGTT AGATGGTGCA CATGCCCCAG AGTTGACCAA AAAGGTTCAG CGACATGCGT
CCAGCAGCTC TTTCCCATCT GGCGGTAGCG AGCACCTGAA AGAAGACCTC AGCCTTCGCC
TGAAGAAGCT GACCCACGCT GCCCCCTGCA TGCTGTTCAT GAAGGGAACA CCCCAGGAGC
CGCGCTGCGG TAAGAGGCTG CTCTTTGCAA GCTGTGCTGT TTTCAGACAC CCTTAGAAGA
CTGGAAAGGT TGTAATTCCC GGTGGGGTCT GCAGGTAGGT GGTGAGAACT CAGCTGCACT
ATTAGAGAAT GTTGGAACCG GAGGCATCCT GGAAGTCATC TGACTCAAGA TCCTTGCTGT
GGACTTAAGT CCTGTCGGAG GCGTGTCACA CCCGGCCTAC TGCGCGGGTT GCCCAGCGGC
AGAGTTGGGA TCAGGGTCCA GCCATCATCC TGCTGTCTCC ATTCTAGGGC TTTCGGCCTG
TTCACTTAAT TTTGTTCTCA ACACTTCTCT TCTCTTTCTT GACAGCCTCA TTTTATTCAC
ATAGTCTGGA TTCAGCAGTT TACAGAATTG TGGACTCCTG CCGTAGTGCA GTGGGTAAAG
GACCTGACTA CAGTGGCTTG GGTCGCCTCG AAGGTGTGAG CTCAGTCCCT GGCCTGGTGT
AGTGGGTTAA GCATCTGGCA TTGCTGCAGT TGCGGAGTAG ATCACAGTTG TGGCCCATAT
TTGATCCCTG GCCTGGGAAC TTCCACATGC CAAGGATTTA GCCAAAAAAA AAAAAAAAA

Deduced amino acid sequence:  (length: 173) [FASTA format sequence]
MAAGAAEAAA AVVEVGSAGQ FEELLRLRAK SLLVVHFWAP WAPQCAQMND VMAELAKEHP
QVSFVKLEAE AVPEVSEKYG ISSVPTFLFF KNSQSIDRLD GAHAPELTKK VQRHASSSSF
PSGGSEHLKE DLSLRLKKLT HAAPCMLFMK GTPQEPRCGK RLLFASCAVF RHP


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin-3 [Homo sapiens]. 2601e-69
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Homo sapiens]. 56.25e-08
Contig/Assembly ProteinTXNthioredoxin [Homo sapiens]. 53.53e-07
Contig/Assembly ProteinTXNDC2thioredoxin domain-containing protein 2 isoform 1 [Homo sapiens]. 53.14e-07


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGlrx3glutaredoxin-3 [Mus musculus]. 2617e-70
Contig/Assembly ProteinTxnl1thioredoxin-like protein 1 [Mus musculus]. 56.24e-08
Contig/Assembly ProteinTxndc2thioredoxin domain-containing protein 2 isoform 1 [Mus musculus]. 55.86e-08
Contig/Assembly ProteinTxn1thioredoxin [Mus musculus]. 51.21e-06


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC477869PREDICTED: similar to Thioredoxin-like 2 protein (PKC-interacting cousin of thioredoxin) (PKCq-interacting protein) (PKC-theta-interacting protein) [Canis familiaris]. 2585e-69
Contig/Assembly ProteinLOC474798PREDICTED: similar to Thioredoxin (ATL-derived factor) (ADF) (Surface associated sulphydryl protein) (SASP) [Canis familiaris]. 521e-06


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin-3 [Bos taurus]. 2654e-71
Contig/Assembly ProteinTXNL1thioredoxin-like protein 1 [Bos taurus]. 55.58e-08
Contig/Assembly ProteinTXNthioredoxin [Bos taurus]. 53.92e-07O


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinGLRX3glutaredoxin 3 [Sus scrofa]. 2778e-75
Contig/Assembly ProteinTXNthioredoxin [Sus scrofa]. 54.31e-07


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-202884.1CTTTCTTGACAGCCTCATTTTATTCACATAGTCTGGATTCAGCAGTTTACAGAATTGTGG


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531S-0322661fwd
2003082620030826S-0393411fwd
2004020420040204S-0468331fwd
2005032220050322S-0516411fwd
2006061120060611S-0630851fwd
2007080620070806S-0847701fwd
2010100120101001S-1273471fwd
2011060120110601S-1360541fwd