[Help]

[Other Clones] [Human Genome] [RefSeq] [UniGene] [Assembly] 

Clone Name:  OVRM1_0209_G10

Library: OVRM1 (Ovary)
Individual: M1, Meishan (Chinese)

Nucleotide sequence:   (length: 2,691)  [FASTA format sequence]
TTAGCGAAAA GAAGATGTCC ACACCTGTGG AAGTTTTGTG TAAGGGGTTT CCTGCAGAAT
TTGCCATGTA CTTAAACTAT TGTCGTGGGC TGCGCTTTGA GGAAGCCCCG GATTACATGT
ACCTGAGACA GCTATTCCGC ATTCTTTTCA GGACCCTGAA TCACCAATAT GACTACACAT
TTGACTGGAC AATGTTAAAG CAGAAAGCAG CACAGCAAGC AGCCTCTTCA AGTGGGCAGG
GTCAGCAGGC CCAAACCCCC ACAGGTTTCT AAGCATGAAT CGAGGAACAG AAGCAGCAGA
GCAGATGTTC GGAGCAGCAT TTGTTTCTCC CCAAATCTAG ACATTTTAGT TCATATGTAC
ACTAGCCAGT GGCTGTGGAC AACCATTTCC TTGGTGTAAA GAACTTCATT TCGGTATAAA
CTGGCTCTGG GCAGCACTGG CGATACTGCG TCCCGAGTTG TAGCCGCTGT AATTGTGAAT
ATTAACTGAG ATAGTGAGAC ATGGTGTCCA GTTTTCTATT GCATTTTTTC AAGTGGAAAA
GTTAACTGAG TGGTTGACAC ACACAAATTG GTGGACAGAT TGTGCATATG CCAATTGTTT
TGTTAAAACC TTTTCTTTTG AACTATACTG CTTTGAGATC TCACTTCAGA AGAACGGCAT
GAACAGTCTT CAGCCGCAGT TGTGATGGTT GTAAATGCTC GCAGCTGTGC GTTCTTAGGG
TTTCTTCATC CCTGGGGTTT GCAAGTTGTT CACTTAAAAC ATTCTTAACA TGGTTGGCTT
CTTGTGTGCA AGCCAGCTGA TATGGTAGCA ACCAAAGATT CCAGTGTTTG AGCATATGAA
AGACTCTGCC TGCTTACCTG TGCTAGAAAT AACAGCATCT AAAGTGAAGA CTTAAGAAAA
ACTTAGTGAC TACTAGATTA TCCGTAGGAC TCTGCATTAA CTCTATAATG TTCTTGGTAT
TAAAAAAAGC ATATTTGTCA CAGAAATTTA GTTAACATCT TACAACTGAA CATGTGTGTA
TGTTGCTTAG ATAAATGTAA TCACTGTAAA CATCTATATG ATCTGGGATT TTGTTTTTAT
TTTGAAATGG GAGCTCTTTT TTGTTTACAA GTTCATTAAA AACTAAAAAC TGTTTCTGTA
AGGAAATGAG ATTTTTTTAA AAACAAAAAA ATGCCTTGCT GACTCACTAT GAAATCAAAA
TCTCCCCAAT TTTTACGAGA CTATTTCAAG CCATTTGTTA TGTAATTATC CTTTGCAAAT
CATTTTAGAT TTAGTACGAG GACTTCTCAA ATGTTTTTAT TTAAAAATTT TTTTCCCTTG
AAGCGAAAGG CATTCTTACC ATTTTCTTTT TTTAATGACT TGCAGGCGCA ATACCTCGTG
CTGCAGCCGC AAGGGCCAGG ACTTGGTATT GTAACTCCTG CAGCCTCAGA CGAACAGCTG
GACTGATTTT GAATGAGAAT GAAAGCGTTA AAGGGTTTAA CTACAAAATG AAGCTTTTCT
TTAAATTCCT TGCTAATTGG ATCTGAGGAG GTTGACTCCG AAACTTTGGA AAAGCATCTT
ACCTACCCTG TGAGGTTCTG GGATTGCCAG CCCTCCCTGG CTGCACTTCG TCTCAATCCT
TATATGTGGC TCTTTTCTCT TTCTGACCCA AGAAAAAGAA AAGCTAAGCA ATTCTTTAGT
GTAATTTCTT CATTTATAGC ATGTCCAGAT AAATTAAAAG AACTTTTGTC TGAGAAATGC
TGCCAGGCGC CTATTGTCTA AATGTAGGGT ATTTTCTAAA ATAACCTTGA AATTGTAAAT
TGACACGTGT TTGATCAGAT TGTGTCAGGT TTAATTTGTT CCTTTTTTTT TGAAAACCAC
GTTAGCAATA ACTACTTCAG TGACTAACAC GTTCTGCCGT GAAAGGATCC CTGCTGGCAC
CATCACGAGT GTGAACTTGG GGGAGGCAGC TGCTTTGTTT TGTTTCCTTT CTCTCCACCT
CTGTCGGTTA AGGTACTTGT TCCTCGACTA ATAAACCCTT TGATACTTTT AGCCAGAAAT
CAGTCTCATA AAGCTATTTT TGAGTATAGT TTGTGTAAAA TAAAAATGTT TAGCTTTGGT
AATGACTTTT CAAAGCTGAA CTCCCTCTAG CAAGATATTT TTCAGTGCTT TTATTTACTA
TGCACTTAGA CTATGCACTT TTTCTGAAAT ATTTTTGTAA CACTTAACTT TTTTGTATTT
TGCCATTGGA AAAGGTTGTG GTGTAGTTGG TCTGTAATTA ATTACGTTGC AGATGTAAAA
CTGCTGTTAG CTTTGTAAAT CAAACGATAG GTGTTTTGTC CTGGTATATT GTCATTCCAT
TATCTTCACA GTTCACACAA GAAGAATGTG AATTTCAGTG AATGCTGTTA CTAATCCTGT
CGGGAGATGA ATCTCATTTC ACCAAATTAA ATTATGTTTT TCCACTAAAA TGATGGTACA
AGTTGAAGAC ACATCACTTT GAAATTGGAC GACCTCACCA CTTGAGCCCC GCGGTGGCTT
CCTCCGCCGA ACTCGAGGTT ACTCTTGATT TGTTCACCCA CTGGGGGTGC AGTTCCTCTA
AATGTTGGGA GATGGCCATT CTAACTACTG TTGAATGTCT CTGTTTTGGG AAGGTATAAC
AAGAAAATAA AAAAGAATAT ATATGAAGGG AAAAAAAAAA AAAAAAAAAA A

Deduced amino acid sequence:  (length: 85) [FASTA format sequence]
MSTPVEVLCK GFPAEFAMYL NYCRGLRFEE APDYMYLRQL FRILFRTLNH QYDYTFDWTM
LKQKAAQQAA SSSGQGQQAQ TPTGF


SNP mapping information
SNP IDRel.Chr.Location (cM)


Other Clones Sharing Similar Sequences:      TOP

Change score limit to  


Alignment to Human Genome Sequences:      TOP

Change score limit to  


BLAST on RefSeq (Human):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCSNK1A1casein kinase I isoform alpha isoform 1 [Homo sapiens]. 1437e-34
Contig/Assembly ProteinCSNK1A1Lcasein kinase I isoform alpha-like [Homo sapiens]. 1406e-33
Contig/Assembly ProteinCSNK1Dcasein kinase I isoform delta isoform 2 [Homo sapiens]. 1052e-22
Contig/Assembly ProteinCSNK1G3casein kinase I isoform gamma-3 isoform 4 [Homo sapiens]. 67.85e-11


BLAST on RefSeq (Mouse):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCsnk1a1casein kinase I isoform alpha [Mus musculus]. 1451e-34
Contig/Assembly ProteinCsnk1dcasein kinase I isoform delta isoform 1 [Mus musculus]. 1051e-22
Contig/Assembly ProteinCsnk1ecasein kinase I isoform epsilon [Mus musculus]. 1043e-22
Contig/Assembly ProteinCsnk1g3casein kinase I isoform gamma-3 [Mus musculus]. 722e-12


BLAST on RefSeq (Dog):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinLOC479331PREDICTED: similar to casein kinase 1, alpha 1 isoform 15 [Canis familiaris]. 1452e-34


BLAST on RefSeq (Cattle):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCSNK1A1casein kinase I isoform alpha [Bos taurus]. 1451e-34
Contig/Assembly ProteinLOC100300748PREDICTED: casein kinase I alpha-like [Bos taurus]. 1392e-32
Contig/Assembly ProteinLOC100138998PREDICTED: casein kinase I-like [Bos taurus]. 1169e-26
Contig/Assembly ProteinCSNK1G1casein kinase I isoform gamma-1 [Bos taurus]. 72.81e-12


BLAST on RefSeq (Pig):      TOP
LocusDefinitionScoreE valueFL
Contig/Assembly ProteinCSNK1A1PREDICTED: casein kinase I isoform alpha [Sus scrofa]. 1434e-34
Contig/Assembly ProteinCSNK1EPREDICTED: casein kinase I isoform epsilon isoform 2 [Sus scrofa]. 1042e-22
Contig/Assembly ProteinLOC100625051PREDICTED: hypothetical protein LOC100625051 [Sus scrofa]. 96.38e-20


Oligo-microarray probe:      TOP
Probe IDRel.Probe sequence
AGPOA4-140924.1GATGGCCATTCTAACTACTGTTGAATGTCTCTGTTTTGGGAAGGTATAACAAGAAAATAA


Assembly member:      TOP
ReleaseContig/SingletClonesDirection
2003053120030531C-0024592fwd
2003082620030826C-0052363fwd
2004020420040204C-0055343fwd
2005032220050322C-00545618fwd
2006061120060611C-00097020fwd
2007080620070806C-00110521fwd
2008051520080515C-0051495fwd
2010100120101001C-00220034fwd
2011060120110601C-00260935fwd